APMV

AcronymDefinition
APMVAvian Paramyxovirus
APMVApple Mosaic Virus
APMVAndean Potato Mottle Virus (plant physiology)
APMVAssociação Portuguesa de Maternidade e Vida (Portugal)
References in periodicals archive ?
The primer pairs used for one-step RT-PCR were PNRSV CP: v1 (5'ATGGTTTGCCGAATTTGCAAT3'), c1 (5'CTATATCTCAAGCAGGTCTTCATC3'), MP: v1 (5'ATGGCCGGTGTCAGTAAAAAC3'), c1 (5'TCAAGCACTTCCAGAACTACC3'), ArMV: H428 (5'GCGGCGGATTGGGAGTT3'), C867 (5'CGATGGTAGGGGGAGCGTATT3'), ApMV: v1 (5'ATGGTCTGCAAGTACTGTAA3'), c1 (5'TCATAATTCTAACAAATCTT3').
In the analyses, the complete sequences of the coat (CP) and movement (MP) proteins of PNRSV isolates from rose and some Prunus hosts characterized in Brazil or elsewhere, besides CP and MP sequences of PNRSV type group isolates (PV32, PV96 and PE5) and ApMV as outgroup species available in the GenBank were included.
No amplifications by RT-PCR using ApMV and ArMV primers from total RNA extractions of symptomatic rose leaves were observed.
The assayed polyprobe contains a partial sequence of four virus species affecting apple and pear, ASGV, ACLSV, ASPV and ApMV. The complete coat protein gene of these four Brazilian viral isolates have been previously molecularly characterized: ASGV, UV01 isolate (NICKEL et al., 2001), ACLSV, BR1 isolate (SILVA et al., 2008), ASPV, br1 isolate (RADAELLI et al., 2006) and ApMV, M003 isolate (FAJARDO et al., 2011) in studies developed in the Virology Laboratory at Embrapa Grape & Wine, Bento Goncalves-RS, Brazil.
400 nucleotides (nt) per each virus: ApMV, from nt 36 to 435, based on GenBank accession GQ131805; ACLSV, nt 66 to 466 (EF138602); ASGV, nt 42 to 441 (AF438409) and ASPV, nt 147 to 546 (AY572458).
Previous conventional or real time RT-PCR results Identification Cultivar / sample number description ACLSV ASGV ASPV ApMV 42 Williams--pear + + - - 48 Abate Fetel--pear - + + - 195 Maxi Gala--apple - + + + 257 Maxi Gala--apple - + + + 258 Maxi Gala--apple + + + - 260 Maxi Gala--apple - + + - 266 Maxi Gala--apple - + + - 269 Maxi Gala--apple + + + - 270 Maxi Gala--apple - + + - 339 Fuji--apple + + + + 343 Maxi Gala--apple + + + - 344 Maxi Gala--apple + + + - 347 Maxi Gala--apple + + + - 348 Maxi Gala--apple + + + - 353 Maxi Gala--apple + + + - 1097 Nicotiana + occidentalis (tobacco, experimental host) 1157 Fuji Lee - + + - (Mishima)--apple 1160 Braeburn--apple + + + + 1168 Royal Gala--apple + + + + ACLSV cDNA clone + n.d.
APMV (kindly provided by Didier Raoult, Marseille, France) was used as a positive control.
Of the 210 pools, 25 (11.9%) were positive for APMV (viral loads 1.4 x [10.sup.3] to 2.3 x [10.sup.6] copies/mL); 9 (4.3%) pools were capuchin monkey serum and 16 (7.6%) were bovine serum, all from the Amazon region.
Nine of the 12 sequenced amplicons showed high identity among themselves and with the APMV sequence (GenBank accession no.
O efeito do ApMV e especialmente danoso em infeccoes mistas (JONES & ALDWINCKLE, 2002; NICKEL & FAJARDO, 2009).
Os objetivos deste trabalho foram detectar isolados locais de PDV, ApMV e GLRaV-1 e caracterizar molecularmente o gene da proteina capsidial de um isolado de cada especie viral.
'Fuji Standard', 'Imperial Gala', 'Jonagold', 'Pink Lady', 'Golden Delicious' e 'Belgolden', provenientes de pomares comerciais de Vacaria (RS), exibindo sintomas de mosaico foliar ou assintomaticas, foram avaliadas por este mesmo teste quanto a presenca de ApMV. Cinco amostras de videiras das cvs.