ATCT

AcronymDefinition
ATCTAir Traffic Control Tower
ATCTActive Thermochemical Tables
ATCTAirport Traffic Control Tower (FAA)
ATCTAdvanced Thermal Chip Technologies (Israel)
ATCTAll Terrain Camera Tracking (Slough, Berkshire, England, UK)
ATCTAir Traffic Control Transponder
ATCTAnalog Toll Connecting Trunk
References in periodicals archive ?
Ruscic and coworkers [6, 9, 100] included [H.sub.2]O in thermochemical network evaluations (ATcT)--and the most recent ATcT value differs by only about 0.04 kJ [mol.sup.-1] from the original value of Rossini (on the order of the uncertainty in the measurement).
The procured requires the delivery of a wide area multilateration (WAM)-based air traffic control (ATC) system, ATC radio systems, a new air traffic control tower (ATCT) at Manas International Airport and related ancillary equipment and systems integration services required for safe and reliable operations.
(ATCT) recorded a slight increase in the number of Tunisian aid workers and
<p>The event is an initiative of the Arab Administrative Development of the Arab League "ARADO" with the assistance of the Tunisian Agency for Technical Cooperation (ATCT).
The Federal Aviation Administration has awarded MW Builders of Texas a contract in the amount of $9,242,000 for the construction of a new Air Traffic Control Tower (ATCT) and Base Building located in Abilene, Texas.
Forward primer was designed as follows: 5'-ACTAGATCTGCCACCATGTCTGCTGAAGTCAT-3'(AG ATCT is Bg/II Enzyme site, GCCACCATG is Kozak sequence).
Affordable Telecommunications (Pink Sheet: ATCT) has announced it has reached an agreement with InterEdge LLC, a provider of Intelligent Internet 'edge' devices, to form a global wireless communications and services company.
The new 9,000ft (2,743m) runway is scheduled to be commissioned in May 2006, but before that can happen, a new Air Traffic Control Tower (ATCT) is needed to provide a clear line-of-sight to the new Fifth Runway complex.
Locus Chromosome Common sequence Product designation location motif size, bp vWF 12p12-pter [(ATCT).sub.n] 102-132 FGA 4q28 [(TCTT).sub.n] 196-352 CSF 5q33-q34 [(AGAT).sub.n] 291-331 TPO 2p23-pter [(AATG).sub.n] 102-138 D5S818 5q21-q31 [(AGAT).sub.n] 133-169 TH 11p15 [(AATG).sub.n] 146-190 Locus Primer sequence, 5' [right arrow] 3' designation vWF Forward: FAM (a)-AGCTATATATCTATTTATCAT Reverse: AGATACATACATAGATATAGG FGA Forward: FAM-CCATAGGTTTTGAACTCACAG Reverse: CTTCTCAGATCCTCTGACAC CSF Forward: FAM-GAGTCTGCCAAGGACTAGC Reverse: CACACCACTGGCCATCTTC TPO Forward: FAM-ACTAGCACCCAGAACCGTC Reverse: CTTGTCAGCGTTTATTTGCC D5S818 Forward: FAM-AGGGTGATTTTCCTCTTTGGT Reverse: TGATTCCAATCATAGCCACA TH Forward: FAM-GGCTGAAAAGCTCCCGATTA Reverse: TCCCATTGGCCTGTTCCT (a) FAM, 6-carboxyfluorescein.
(TAP) - 19,237 Tunisians have been hired under technical cooperation until July 31, most of whom work in Arab countries, said the Tunisian Agency for Technical Cooperation (French: ATCT).
L'Agence tunisienne de cooperation technique (ATCT) organise le 12 juin prochain, une journee consacree au recrutement de 150 competences tunisiennes, a la faveur d'un test qui sera conduit par un comite compose de representants de 10 entreprises etrangeres, venus d'Oman, de Mauritanie, d'Arabie Saoudite, du Canada, de France et des Pays-Bas.
City and San Antonio Airport System officials welcomed guests to Stinson Municipal Airport for the ribbon-cutting ceremony of the new Air Traffic Control Tower (ATCT).