ATCTC

AcronymDefinition
ATCTCAdvanced Technology Capability and Transition Criteria
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Restriction SNP Primers Sequence (5' to 3') endonucleases TNFRI--609 G/T, Forward CGGACGCTTATCTAT ATCTC Bst4C I rs4149570 Reverse TTGTAGTCCAGTCACAAGCA TNFRI--1207 C/G, Forward TTGGGAGATGTCTGCATCAA BstC8 I rs4149569 Reverse TTCTTCGTTTGCTTGTTTTTCA TNFRII--1709 A/T, Forward GAGTGCTGAGTGAGAAACTG DseD I rs652625 Reverse AGCTTGAATTCGTTCCCAGG TNFRII--3609 C/T, Forward ATGCTTTTGTCCATGCAGGT Msp I rs590368 Reverse GCTGTACCCCGTATTAGCTG SNP: single nucleotide polymorphism; TNFR: tumor necrosis factor receptor.