ATSOAntalya Ticaret ve Sanayi Odasi (Turkish: Antalya Chamber of Commerce; Antalya, Turkey)
ATSOAustralian Technical Standard Order (Civilian Aviation Safety Authority; Australia)
ATSOAir Traffic Service Organization (ICAO)
ATSOAbility To Survive & Operate
ATSOAssociation of Tattoo Studio Owners
ATSOAdvanced Technology and Software Operations Office
ATSOAnatolia Turkish Student Organization (Michigan State University; East Lansing, MI)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
Tursab President and ATSO Deputy President conveyed that they would visit GB during the current year along with a delegation of Tour Operators in order to explore new avenues of cooperation between GB and Turkey.
Tursab President and ATSO Vice President conveyed that they would very
Tursab President and ATSO Vice President conveyed that they would very soon visit GB along with a delegation of tour operators in order to explore new avenues of cooperation between GB and Turkey.
Kolesnik met with the deputy chairman of ATSO Adnan Vucudi Ozen.
Whether this will be combined with their existing ASO certification (ATSO: AIDS TB Standard Organization) or serve as a standalone certification is still to be decided.
English and American piracy adopted various forms and was a major problem for trading through the Indian Ocean, not only for Indians and other Asians essentially committed to peaceful commerce, but atso for the Anglophones themselves.
Primer Sequence (a) Pi*S allele ATSO GGTGCCTATGATGAAGCGTTTAGGC ATS2 AGGTGTGGGCAGCTTCTTGGTCA AATSA TTCTTCCTGCCTGATGAGGGGAAACTA-fluorescein AATSM LC-red640-GCACCTGGAAAATGAAC-p Pi*Z allele ATZO TCCACGTGAGCCTTGCTCGAGGCCTG ATZ2 TTGGGTGGGATTCACCACTTTTC AATZA CTCCAGGCCGTGCATAAGGCTGT-fluorescein AAT7M I r_rarlRan_r~rrATrrArrArAAArrr_n Primer Position (b) Orientation PCR product Pi*S allele 238 by ATSO 9488-9512 Sense ATS2 9725-9703 Antisense AATSA 9591-9617 Sense AATSM 9620-9636 Sense Pi*Z allele 253 by ATZO 11 843-11 868 Sense ATZ2 12 095-12 073 Antisense AATZA 11904-11926 Sense AAT7M 11 930-1 948 Sense (a) Variable nucleotides in the detection probes are underlined.
His music is performed with patriotic fervour and understanding by the Kuopio Symphony Orchestra under Atso Almila.
The Happy Health line atso is fatfree and made with completely natural ingredients.
The program atso indicates whether and to what degree clinical findings mandate diagnostic evaluation, provides a list of other associated conditions, and offers possible complications of the disease.
Ercan Mutlu, Vice President, Antalya Chamber of Commerce and Industry (ATSO) and Firuz Baglikaya, President, Turkish Travel Agencies Association (Tursab).
Antalya KE-ltE-r Sanat (Antalya Culture and Arts), located in the city center, on a lot where the Antalya Chamber of Commerce and Industry (ATSO) headquarters was previously situated, was introduced to members of the press during a preview on Thursday.