AR

(redirected from Acute Rejection)
Also found in: Dictionary, Thesaurus, Medical, Legal, Financial, Encyclopedia.
AcronymDefinition
ARArgentina
ARArkansas (US postal abbreviation)
ARAssault Rifle
ARArgon
ARAccounts Receivable
ARArabic
ARAdministrative Record
ARArmy Regulation
ARAmateur Radio
ARAnnual Report
ARAccelerated Reader
ARAdventure Racing
ARAnimal Rights
ARArmy Reserve
ARAs Required
ARAnnual Reviews
ARAction Required
ARAmerican Revolution
ARAction Replay (game console cheat device)
ARActive Region (sunspot observation)
ARAmerican Racing (American Racing wheels)
ARAction Research
ARAir Rifle
ARAnnual Rate
ARAccess Router
ARAmazing Race (reality TV show)
ARAcrobat Reader (Adobe Systems)
ARArmor
ARAnti-Reflection
ARAutomatic Rifle
ARAcid Reflux
ARAbuse Report (gaming, Second Life)
ARAugmented Reality
ARAnti-Reflective
ARAspect Ratio
ARAcoustic Research (loudspeaker manufacturer)
ARAuthorized Representative
ARAnnual Return
ARAfter Rebate
ARAbbey Road (Beatles album/song)
ARAromatic
ARAndrogen Receptor
ARArgent (Heraldic White or Silver)
ARAction Report
ARArizona Republic (newspaper)
ARActivity Reports
ARAntibiotic Resistance
ARAccount Representative (Sprint)
ARAdrenergic Receptor (protein)
ARRepair Ship
ARAishwarya Rai (Indian actress)
ARAbnormal Returns
ARAyn Rand (novelist and philosopher)
ARAuthorized Reseller
ARArmalite (rifle company)
ARAll Risks
ARAerolíneas Argentinas
ARAssociation Rules
ARAtlantic Records (record label)
ARAdministrative Regulation (various organizations)
ARAddress Register
ARAutoregressive
ARAlternate Routing
ARAppenzell Außerrhoden (Swiss Half Canton)
ARArmaLite Rifle (engineering company; Genesco, IL)
ARAssistant Referee (sports)
ARAllergic Rhinitis
ARAkademia Rolnicza (Polish: University of Agriculture)
ARAs Removed (avionics)
ARAutomated Reasoning
ARAlan Rickman (British actor)
ARAutosomal Recessive (genetics; recessive gene on one of the 23 pairs of autosomes)
ARAlternative Radio (public affairs program)
ARAssembleia da República (Portuguese parliament)
ARArrêté Royal (French: Royal Decree; Belgium)
ARAdverse Reaction
ARAccusé de Réception (French: Acknowledgment of Receipt; mail)
ARArtificial Respiration (aka artificial resuscitation)
ARAnalyst Relations (various locations)
ARAntimicrobial Resistance
ARAtmospheric Research
ARAncien Regime (gaming)
ARAdrenaline Rush (gaming; also an IMAX film)
ARArsenide
ARAcknowledge Receipt
ARAir Route
ARArea Record (sports)
ARAir Refueling
ARArmy Ranger
ARAortic Regurgitation (aortic insufficiency)
ARAnal Retentive
ARAir Resistance
ARArea Ratio
ARArista Records (record label)
ARAttributable Risk
ARAppenzell Ausser-Rhoden (postcode, Switzerland)
ARAldose Reductase
ARAcute Rejection
ARAmerican Robin
ARAerial Refueling
ARAngle Resolved
ARAll Rail
ARAttrition Rate
ARAccess Right
ARAbandon Rate
ARArm's Reach
ARArezzo, Toscana (Italian province)
ARAuthorization Request
ARAnti-Radiation
ARAqua Regia
ARAerial Reconnaissance
ARAgency Resources
ARArrest Report (law enforcement)
ARAttack Rating (Diablo II)
ARAcquisition Reform
ARAutonomous Republic
ARAccess Rate
ARAssistant Registrar
ARAutomatic Response
ARArea Representative
ARAvis de Réception (Canada Post)
ARAge Regression
ARAfrican Rights
ARAnti-Radar
ARAtrophic Rhinitis (pig respiratory disease)
ARAxial Ratio
ARAncestral Roots (genealogy)
ARApproval Request
ARAir Reconnaissance
ARActive Radar
ARActivity Ratio
ARApproximate Reasoning
ARAttack Release
ARAnton Rubinstein (classical pianist)
ARAuto Redial
ARAnalytical Reagent
ARAirborne Reconnaissance
ARAftermath Records (record label)
ARAgent Report
ARAdd Register
ARAbstellraum (German: storage room)
ARAcceptance Review
ARAsistencia Respiratoria
ARAcquisition Risk
ARArt Remains (online art gallery)
ARAffiliate Relations
ARAccounts Register
ARAcquiescence Ruling
ARApplication Record
ARAutomation Resources
ARAutomatic Recall (Bellcore)
ARAcetal Resin
ARArrezo (postcode, Italy)
ARAdvanced Reactor
ARAcoustic Reflex
ARAssociate Referee (various organizations)
ARAlarm Reaction
ARAdministrative Requirement
ARAssessment Request
ARAmerican Rifleman Magazine
ARArmor Rating (gaming, Asheron's Call 2)
ARAuxiliary Relay
ARAcquisition Request
ARAlabama Railroad
ARAlarm Report
ARApproved Rejected
ARAir Revitalization
ARAsset Reconciliation
ARAnomaly Report
ARApplication Requester
ARArtificial Resuscitation
ARAuburn Reporter (community newspaper)
ARAnti-Reflectance
ARArise Records
ARAirworthiness Representative
ARActivity Resume (ITU-T)
ARAirborne Relay
ARAmerican Rivers, Inc.
ARAdvice of Receipt (Canada Post)
ARAbsorber Rod
ARAcoustique Renforcée (French: Enhanced Acoustics; window noise insulation)
ARAuxiliary Room
ARArchival Researcher
ARAffirmative Rebuttal (debate)
ARAttrition Reserve (aircraft)
ARPostal Fiscal (Scott Catalogue prefix; philately)
ARAtmospheric Revitalization
ARAutomatic Resupply
ARAuxiliary Receiver
ARAvance-Retard (French)
ARAuscultacion Respiratoria (Spanish: Respiratory Auscultation)
ARArrow Revolver (game, Mabinogi)
ARAllied Racing (Halo racing clan)
ARAttributive Risk
ARASR Status
ARArmor Rendering (gaming, Asheron's Call)
ARArgonne Area Office (US DOE)
ARAltesse Royal (French: Royal Highness)
ARAeronautical Requirement
ARAdaptive Reception Control
ARArchitecture and Requirements Office (NIMA)
ARAutomation Recall
ARAmusement Radio (online radio station)
ARAnno Resurrectionis (Year of the Resurrection, epigraphy)
ARAgonist Reversal (PNF technique)
AREnd of message / Out (logging abbreviation)
ARAllotment Reconciliation
ARAgent Requisitions
References in periodicals archive ?
The incidence of three predictors (medication nonadherence, acute rejection, and change in kidney function) and one outcome (graft loss) were analyzed.
11) This working formulation provides not only the characteristic morphologic features of ACR but also a grading scheme for both acute rejection and small airways inflammation.
Out of 37 patients treated for acute rejection (11 received induction therapy) 17 (46%) developed CMV infection/disease, seven after treatment with methylprednisolone and 10 after treatment with methylprednisolone and r-ATG.
In contrast, acute rejection, multiple bile ducts, and pretransplant serum albumin level were identified as the independent risk factors for BCs occurring beyond 6 months after LT.
Table 1: Primers sequences, restriction enzymes and the size of digested and undigested PCR products Locus Primers CD40 Forward: GAAACTCCTGCGCGGTGAAT (rs1883832) Reverse: CCTCTT CCCCGAAGTCTTCC IL-18 Forward: AGGTCAGTCTTTGCTATCATTCCAGG (rs1946519) Reverse: CTGCAACAGAAAGTAAGCTTGCGGAGAGG Locus Fragment sizes restriction (bp) enzymes CD40 CC: 133 + 74 + 85 Sty1 (rs1883832) CT = 133 + 74 + 85 + 207 TT: 207 + 85 IL-18 TT: 120 Mwo I (rs1946519) GT: 120 + 96 + 24 GG: 96 + 24 Table 2: The frequencies of IL-18 and CD40 genotypes and alleles in patients with acute rejection and non-acute rejection Gene Genotype Rejection Non Rejection P.
The incidence of one episode of acute rejection is 85%, and 56% of recipients experience multiple episodes of rejection.
Therefore in our study acute rejection episodes were coincidental in PTE group.
This confirms that, once the hazards of acute rejection are overcome, the heterotopically transplanted heart can function physiologically and afford the recipient full rehabilitation.
The donor lung resulting from Traumatic Brain Injury may predispose the recipient to acute rejection episodes and Bronchiolitis Obliterans Syndrome.
Among specific topics are immunological principles of acute rejection, donor heart selection, pediatric lung transplantation, living donor liver transplantation, peri-operative care and early complications in kidney transplantation, intestinal transplantation, corneal transplantation, and the legal and operational framework of transplant service in Europe and the US.
About 25 percent of kidney recipients and 40 percent of heart recipients experience an episode of acute rejection in the first year after transplant.
Full browser ?