In addition, the research team found that Iressa, a cancer drug that blocks the epidermal growth factor receptor, effectively stopped the proliferation caused by
amphiregulin.
Phosphorylation of TNF-[alpha] converting enzyme by gastrin-releasing peptide induces
amphiregulin release and EGF receptor activation.
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc;
amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.
Results from gene expression profiles have shown that tumours that express high levels of the EGFR ligands epiregulin (EREG) and
amphiregulin (AREG) are more likely to have disease control with cetuximab (EREG, P=0.
For example,
amphiregulin (AR) showed a relatively high response to [E.
Expression of epiregulin and
amphiregulin and K-ras mutation status predictdisease control in metastatic colorectal cancer patients treated with cetuximab.
