B2M

AcronymDefinition
B2MBeta-2-Microglobulin
B2MBusiness to Machine
B2MBoyz to Men
B2MBusiness to Market
B2MBack to Mom's
B2MBusiness 2 Media (Nigeria)
References in periodicals archive ?
Primer sequences and their related PCR product sizes used for real-time RT-PCR Gene Forward primer (5'[right arrow]3') CRISP2 TGCCATTATTGTCCTGCTGGT CATSPER1 AAGGGCAATTTCAGAAACGCA PATE1 TCTGCTGCTTTAGGGCGTTAT SEMG1 CCAGACACCAACATGGATCTCA B2M CGAGATGTCTTGCTCCGTG Gene Reverse primer(5'[right arrow]3') Size (bp) CRISP2 CATGTTCACAGCCAGTTGTATTCT 187 CATSPER1 TCAAAGGCCAAGGATTGGGTTA 157 PATE1 GGTGGCACATCCTACACTGA 120 SEMG1 TGAGGTCAACTGACACCTTGATA 179 B2M TCCATTCTCTGCTGGATGAGG 118 Table 2.
A multiplex RT-qPCR assay was developed for TWIST1, VIM, CDH2, and B2M gene transcripts.
In this study, we found that B2M in whole unstimulated saliva can distinguish between SS and snSS, and also between SS and HC.
Neither the median serum albumin levels nor B2M levels were significantly different between the two groups.
Target gene expression was calculated from Cp value, and normalized to expression of housekeeping gene b2-microglobulin (B2M) to get relative expression.
Objective: To determine the levels of serum lactate dehydrogenase 2 (LD2) Isoenzyme and b2 microglobulin (b2m) in patients of non-Hodgkin's lymphoma (NHL) and to correlate these levels in NHL patients with and without bone marrow infiltration.
demonstrated that PCLI and B2M measured at diagnosis are independent prognostic factors in MM [12].
Target gene PCR E 0.1 ng stability (SD) 1.6 ng stability (SD) ACTB 1.91 5.70 1.14 B2M 1.90 2.54 1.08 GUSB 1.93 0.84 GAPDH 1.80 2.25 HPRT1 1.94 1.43 1.23 HSP90AB1 1.95 1.46 1.02 LDHA 1.94 1.84 NONO 1.96 1.39 0.84 PGK1 1.92 4.11 1.21 PP1H 1.93 0.77 RPLP0 1.92 4.30 1.02 TFRC 1.91 3.12 1.06 TABLE 2: Significant differences in gene expression between the biopaper and PET coculture systems at each time point.
RT-PCR primers for superoxide dismutase 1 (SOD1), catalase (CAT), [beta]-2-microglobulin (B2M), and actin (ACT) were manufactured from Sigma-Aldrich.
Expressions of target genes were normalized to the geometric average expression of the three reference genes hypoxanthine-guanine phosphoribosyltransferase 1 (Hrpt1), beta-2 microglobulin (B2m), and 18S ribosomal RNA (18S) as described [21].