B2MG

AcronymDefinition
B2MGBeta 2 Microglobulin
References in periodicals archive ?
A total volume of 25 [micro]L was used; the volume included 12.5 [micro]L of TaqMan Universal MasterMix (Life Technologies, Carlsbad, CA, USA) and 5 [micro]L of template DNA for the Plasmodium genus and B2MG assay as well as 3 [micro]L of template DNA for HSV-1, HSV-2, EBV, and CMV assays.
Length Gene Accession number Sequence 5'-3' (base pairs) LEP NM_001163980.1 For: CACGCAGTCAGTCTCCTCCA 101 Rev: TTGCCAATGTCTGGTCCATC LEPR XM_005610519.1 For: CCCACTTCATCGCCAAAAGA 179 Rev: CCCATTTGATCACAGCCACA GHR XM_001491134.4 For: GTTCAACGCCCCCTTTGAT 101 Rev: CCTCCCAGAGGATGTCCTGA Ghr-R1A XM_001494000.1 For: TCATCAGCAGGAAGCTGTGG 178 Rev: CCAGGCTCAAAGGATTTGGA B2MG X69083 For: CGGGCTACTCTCCCTGACTG 92 Rev: TTGGCTTTCCATTCTCTGCTG