BAK1

AcronymDefinition
BAK1BCL2 Antagonist/Killer 1
References in periodicals archive ?
The Bcl-2 family controls apoptotic mitochondrial events (Cory and Adams, 2002); BAK1 and Bcl-xL have roles in pro- and anti-apoptotic signaling, respectively (Elmore, 2007); Caspase3 acts during the apoptosis execution phase by initiating DNA fragmentation (Stennicke and Salvesen, 1998); and TP53 is a cell cycle regulator that can activate apoptosis (Fridman and Lowe, 2003).
1 R : CGCACTTCATGATCGAGTTG BAK1 F:CAGCCGACAGCGGAAAAC 109 AJ001204.
For example, BAK1 and CASP2 are both pro-apoptotic and have been shown to induce apoptosis in vitro and in vivo in several cell types (Kumar 2009; Pataer et al.
Genes with decreased expression in the cells included the proapoptotic gene BAK1 and the cell cycle control gene p15INK4B.