BALP

AcronymDefinition
BALPBone Alkaline Phosphatase
BALPBaseline Bone Alkaline Phosphatase
BALPBristol Active Life Project (UK)
BALPbronchoalveolar lavage fluid
BALPBruce Power A Limited Partnership (energy industry; Canada)
BALPBarclays Africa Leadership Programme
BALPBiologically Active Linear Polysaccharides
References in periodicals archive ?
Physiologically, BALP adheres to osteoblastic cell membrane with only small amount released in serum.
Effects of radium-223 dichloride (Ra-223) with docetaxel (D) vs D on prostate-specific antigen (PSA) and bone alkaline phosphatase (bALP) in patients (pts) with castration-resistant prostate cancer (CRPC) and bone metastases (mets): A phase 1/2a clinical trial.
Gene Accession Forward primer number BALP NM000478 GGCTCCAGGGATAAAGCAGGT Osteocalcin NM199173 ATGAGAGCCCTCACACTCCTCG RUNX2 NM001024630 TTCTGCCTCTGGCCTTCCAC BMP4 NM001202 GCTTGTCTCCCCGATGGGATT OPN NM001251830.1 GCAGACCTGACATCCAGTACC cMyc NM002467.4 TTCTCTCCGTCCTCGGATTCT Axin2 NM004655.3 GACAGGTCGCAGGATGTCTG Cyclophilin NM021130 GTCAACCCCACCGTGTTCTT Gene Reverse primer BALP AGTGTCTCTTGCGCTTGGTCT Osteocalcin GTCAGCCAACTCGTCACAGTCC RUNX2 TGGAGAAGCGGCTCTCAGTG BMP4 CTCGGGATGGCACTACGGAA OPN GATGGCCTTGTATGCACCATTC cMyc TTGTTCCTCCTCAGAGTCGCT Axin2 TGTGCTTTGGGCACTATGGG Cyclophilin CTGCTGTCTTTGGGACCTTGT
Serum BALP concentrations were determined with an IRMA kit (Ostase, BeckmanCoulter), with interassay CVs of 9.2% at a serum concentration of 17 [micro]g/L, 8.5% at 40 [micro]g/L, and 7.5% at 82 [micro]g/L, and a detection limit of 2 [micro]g/L.
The mean serum calcium level increased from 2.19 +/- 0.1 to 2.25 +/- 0.1 mmol/l (p = 0.009), the intact parathyroid hormone (iPTH) level decreased from 144 +/- 108 to 108 +/-63 pg/ml (p = 0.05), and the bone alkaline phosphatase (BALP) level remained unchanged.
The concentrations of osteocalcin (OC), PIMP, PICP and bone-specific alkaline phosphatase (BALP) in serum correlate with the rate of bone formation.
We measured the following biochemical markers related to bone metabolism: PTH, osteocalcin, and bone alkaline phosphatase (bALP) in serum; and deoxypyridinoline (U-DPD) and calcium in urine.
The project is being financed by the owners of the Bruce A Limited Partnership (BALP), consisting of Trans Canada Pipelines and BPC Generation Infrastructure Trust, each with 47.4 percent interest, with the remainder shared between the Power Workers Union and the Society of Energy Professionals.
Alice Charlotte Alexandra Jim Hiram Keller The Mother Rita Meiden The Father Bruno Balp Grocer Shirley Stoler If nothing else, "A Real Young Lady" -- Catherine Breillat's first film, shot in 1975, but never released because her producer went bankrupt -- proves that the signature ingredients of all her subsequent forays into film (and literature) were already firmly in place 25 years ago: a forthright expression of female desire, a bold approach to genitalia and bodily fluids and, uh, cheesy voiceover.