BAMH

AcronymDefinition
BAMHBetter Access to Mental Health
BAMHBaring Asset Management Holdings (UK)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Name of shRNA Sequence sh500-sense 5'-GATCC GGAGGACGATCAGATTGAA gagtactg TTCAATCTGATCGTCCTCCTTTTTTC-3' sh500-antisense 5'- TCGAGAAAAAA GGAGGACGATCAGATTGAA cagtactcTTCAATCTGATCGTCCTCC -3' Sh614-sense 5'-GATCCGGATGTCTCATAACGCCAT gagtactg ATGGCGTTATGAGACATCCTTTTTTC-3' sh614-antisense 5'-T CGAGAAAAAAGGATGTCTCATAACGCCAT cagtactc ATGGCGTTATGAGACATCC-3' Shl006-sense 5'-GATCCGGCTTTGTGAACCTTGACT gagtactg AGTCAAGGTTCACAAAGCC TTTTTTC-3' sh!006-antisense 5'-TCGAGAAAAAA GGCTTTGTGAACCTTGACT cagtactc AGTCAAGGTTCACAAAGCC-3' Three shRNAs (numbers stand for their position in cDNA) were designed, and each shRNA was added with restriction sites BamH I and Xho I.
In the early 1960s, Senegal created the BAMH (Bureau d'architecture des monuments historiques), the office of Historical Monuments Architecture.
The following polymorphic sites of the hemoglobin ("beta globin-like") gene cluster on chromosome 11 were analyzed: site 1: 5'[epsilon] (Hinc II); site 2: 5' [sup.G][gamma] (Xmn I); site 3: [sup.G][gamma] (Hind III) site 4: A[gamma] (Hind III); site 5: [psi][beta](Hinc II); site 6: 3' [psi][beta] (Hinc II); site 7: 5' [beta] (Hinf I); site 8: [beta] (Ava II); site 9: 3' [beta] (Hpa I) and site 10: 3' [beta] (BamH I).
strain C-61 was partially digested with Sau3A1 and ligated into BamH I site of ZAP expression vector (Stratagene).
A set of eight restriction enzymes was used, which included two six-cutter (BamH I and EcoR I) and six four-cutter (Dde I, Dra 1, Hae III, Hinf I, Msp 1, Rsa I).
We used the following restriction enzymes: Alu I, Apa I, Ase I, Ava I, Ava II, BamH I, Bcl I, Bgl I, Bgl II, BstE II, BstU I, Dpn II, EcoR I, EcoR V, Hae II, Hae III, Hha I, Hinf I, Hind III, Kpn I, Mse I, Msp I, Nci I, Pst I, Rsa I, Sac I, Sac II, Sau96 I, Sca I, Stu I, Taq I, Xba I, and Xho I.
La digestion del fragmento de 1033 bp generado por la amplificacion del gen pol-env con las enzimas Hind III, BamH I y Pst I no revelo ninguna variacion en el patron de los aislados en relacion con los obtenidos con las cepas MT-2 y ATK-1 (36).
Aliquots of the 4-kb PCR products then were digested with the restriction enzymes Apa I, Ase I, BamH I, Bsr I, BstU I, EcoR I, Hha I, Hinc II, Hind Ill, Hinf I, Pst I, Rsa I, Ssp I, and Taq I (5-8 [[micro]liter] per reaction).
The PCR product was digested with Xho I and BamH I and then ligated to the pET15bTat-GFP-Tat plasmid which was linearized with the same enzymes, resulting in the recombinant plasmid pET15bTCTA1T.
BC093054.1) and was cloned into EcoR I and BamH I of plasmid pLenO-GFP (GenePharma, China).
The codon-optimized pBD-2 and cecropin P1 genes were synthesized by Sangon (Shanghai, China) and cloned into pMK4 vector by BamH I and EcoR I sites to construct pBD-2/cecropin P1 expression vector pMK4-BD/CP/His, in which the pBD-2 and cecropin P1 genes were fused by linker and tagged by 6xHis, and controlled by Lac promoter.
BamH I, Hind III and Bgl II were the products of TaKaRa Biotechnology Co., Ltd.