BIOB

AcronymDefinition
BIOBBlame It on Bush
BIOBBighorn In Our Backyard (Canada)
BIOBBirkenhead Institute Old Boys (alumni group)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
felis bioB (0527) ATGTTCGGGCTTCCGGTATG 6FAM-GCTGCGGCGGTAT CCGATTCAGCAGGTTCTTCAA TTTAGGAATGGG-TAMRA orfB CCCTTTTCGTAACGCTTTGCT 6FAM-TGTTCCGGTTTTAA GGGCTAAACCAGGGAAACCT CGGCAGATACCCA-TAMRA vapB1 TGTCTTTCATGAATTGATCAGCA 6FAM-AAGGCTTGGTT AGGCGAAAGCTTTGACGTG TCTGCGGGC-TAMRA * The origin of the quantitative PCR is described in (14).
El protocolo de asepsia optimizado permitio obtener resultados promedios de desinfeccion del 85% para el clon ICS95 y del 96% para el clon BIOB, porcentajes considerados altos para genotipos cuya procedencia fue de campo, donde se reconoce que la carga microbiana es mayor que para plantas provenientes de invernadero.
Los embriones somaticos en estado globular fueron evidentes 15 dias despues del subcultivo en los medios SCG e INDExp, principalmente en las bases de petalo para el clon ICS95 y exclusivamente en los estaminodios para el clon BIOB. Sin embargo solo los embriones del clon BIOB alcanzaron la etapa cotiledonar.
Los embriones somaticos del clon BIOB, 45 dias despues de ser transferidos al medio MM6, alcanzaron una altura no superior a un centimetro, un numero de hojas inferior a 2 y solo iniciaron la formacion de la raiz principal.
Interestingly, these 10 probe sets were part of the 18 probe sets that are designed to detect the set of hybridization exogenous controls recommended by Affymetrix: BioB, BioC, BioD, and Cre (7).
A spokesman for BIOB said: "We welcome the attempts being made by Tranmere Rovers Supporters Trust to secure the long-term future of the club through their buyout proposal.
A group from the Birkenhead Institute Old Boys (BIOB) met with Wirral council and insisted they are involved in future discussions over the removal and re-siting of the war memorial should development proceed.
Founder of the Wilfred Owen Story museum in Birkenhead, and a member of BIOB, Dean Johnson, said: "As old boys of the school, we are stakeholders in the eventual outcome of their destiny and the proposed setting of a corner of the housing estate is insulting and unacceptable." ?
Samples were screened by quantitative real-time PCR (qPCR) targeting the biotin synthase (bioB) gene (4).
felis species-specific real-time qPCR and the confirmatory qPCR, with mean cycle thresholds [+ or -] SDs of 37.34 [+ or -] 1.7 (bioB gene; mean copies/mosquito 5 x [10.sup.2] [minimum 1.2 x [10.sup.2] , maximum 1.4 x 103]) and 33.64 [+ or -] 1.4 (orfB gene; mean copies/ mosquito 5 x 102 [minimum 1.5 x 102, maximum 1 x [10.sup.3]).
The Oligo B2 contains the Poly-A Controls (Dap, lys, phe, thr, and trp) and the Hybridization Controls (bioB, bioC, bioD, and cre) as part of the GeneChip Eukaryotic Hybridization Control Kit.
For hybridization, 15 lag of the fragmented cRNA probe was incubated with 50 pM control oligonucleotide B2, 1x eukaryotic hybridization control (1.5 pM BioB, 5 pM BioC, 25 pM BioD, and 100 pM cre), 0.1 mg/mL herring sperm DNA, 0.5 mg/mL acetylated bovine serum albumin, and 1x hybridization buffer in a 45[degrees]C rotisserie oven for 16 hr.