BQCV

AcronymDefinition
BQCVBlack Queen Cell Virus (honey bee disease)
References in periodicals archive ?
In summary, the findings described here demonstrate the first report of infection of Bombus atratus with DWV, SBV and BQCV in commercial bumblebee colonies of Argentina.
Sequence Orientation Target AIKVf GGTGCCCTATTT AGGGTG AGG A Sense ABPV - IAPV - KBV ABPVr ACTACAGAAGGCAATGTCCAAGA Antisense ABPV IAPVr GGGAGTATTGCTTTCTTGTTGTG Antisense IAPV KBVr T GCACGGGAAGTATAAATAATTCT Antisense KBV DWVf TGGTCAATTACAAGCTACTT GG Sense DWV DWVr TAGTTGGACCAGTAGCACTCAT Antisense SBVf CGTAATTGCGGAGTGGAAAGATT Sense SBV SBVr AG ATTCCTTCGAGGGT ACCTCATC Antisense CBPVf AACCTGCCTCAACACAGGCAAC Sense CBPV CBPVr ACATCTCTTCTTCGGTGTCAGCC Antisense BQCVf CTTTATCGAGGAGGAGTTCGAGT Sense BQCV BQCVr GCAATAGATAAAGTGAGCCCTCC Antisense Amplicon length (bp) AIKVf ABPVr 460 IAPVr 158 KBVr 641 DWVf 269 DWVr SBVf 342 SBVr CBPVf 774 CBPVr BQCVf 536 BQCVr
PRESENTE LISTA ENFERMEDAD/ NOMBRE COMUNAGENTE ETIOLOGICO EN ESPANA OIE VIRUS Virus de la paralisis APV NO aguda Virus de la paralisis CPV SI NO cronica Virus Kashmir KBV SI * NO Virus de las alas DWV SI * NO deformadas Virus de la cria SBV NO sacciforme Virus de la realera BQCV SI * NO negra Virus filamentoso -- NO Virus de las alas CWV SI * NO opacas Virus Y BVY NO Virus X BVX NO Virus de la paralisis SPV NO lenta Virus asoc.