BRCR

AcronymDefinition
BRCRBrices Cross Roads National Battlefield Site (US National Park Service)
BRCRBreathing Retraining with Cognitive Restructuring (behavior research)
References in periodicals archive ?
Phylogenetic analysis placed all CVA6 strains from the HFMD outbreak in 1 cluster (97%-100% identity), whereas the nucleotide identities between those isolates and CVA6 prototype strains Gdula, CAV16, G-10, and enterovirus 71 BrCr were 82.5%-83.2%, 55.6%-56.6%, and 55.6%-57.3%, respectively.
The phylogenetic tree, drawn on the basis of the alignment of the VP1 gene sequences, showed 3 independent genogroups (A, B, and C) with the prototype BrCr strain as the only member of genogroup A (11).
Comparison of a 338-nt sequence with that of the CVA-16 reference strain (prototype BrCr) and the EV 71 reference strain (prototype G-10) showed nucleotide identity rates of 78.6% and 64.6%, respectively.
Primer pairs 159/162 and 161/NP1A (24) were used for VP1 amplification of nucleotides (nt) 2385 to 2850 relative to BrCr; for VP4 amplification, the primers VP2-REV (5' TTCCAATACCACCCCTTGGATGA 3') and EVP-2 (19) were used to amplify nt 449 to 1192 relative to BrCr.
The VP1 nucleotide sequence of HEV71 BrCr strain (25) was obtained from GenBank.
The deduced VP1 amino acid sequences of these four strains were compared with that of BrCr (Table 5).
We compared the VP4 nucleotide and deduced amino acid differences of HEV71 strains, BrCr (25), E1387 (15), OC/9632, OC/99-Ikeda, OC/0078, OC/00219, and OC/00260.