BRPA

AcronymDefinition
BRPABusiness Resumption Planners Association (est. 1989; Chicago, IL)
BRPABritish Recovered Paper Association (est. 1997; recycling; UK)
BRPABlue Ridge Parkway Association
BRPABlue Ridge Power Agency (est. 1988; Virginia)
BRPABoston Rental Property Association (Boston, MA)
References in periodicals archive ?
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
Protein sequences for gtfC (BAA26102), gtfB (BAA26105), brpA (NP_720858) and spaP (NP_721042) were downloaded from NCBI database.
The binding pockets and active sites of selected structures (brpA, gtfB, gtfC and spaP) were identified by using POCKET finder programme (www.modelling.leeds.ac.uk/pocketfinder).
Sources said unfortunately the perception of intelligence agencies involvement in this tragic incident is being created by some members of few political parties and militant organizations like BLA, BRPA, BLNF and BLF as part of their ongoing propaganda campaign.