BSUB

AcronymDefinition
BSUBBatch Submission
BSUBBall and Socket Upper Bearing
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The annealing temperature was 56[degrees]C for Bmin and Bsub, 57[degrees]C for Bani and Bbif, 58[degrees]C for Bbre, Bcat, and Bthe, 60[degrees]C for Bin, as well as 62[degrees]C for Bang and Blon.
subtile Bsub F AAGACTACGAGGTCAAG 17 Bsub R TGTGCTCGTCGACCTGAGAT 20 B.thermophilum Bthe F GACGGCGAAGACAATTTT 18 Bthe R AGCAGAACTGGTCA 15 Target Product Target group Primer site size (bp) Location Bifidobacterium P0 1,427 16S rRNA gene Lm3 B.