BTVS

AcronymDefinition
BTVSBuffy The Vampire Slayer
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Seg-2/VP2 of KUW2010/02 showed nucleotide/amino acid identity levels of 42.8%/28.3% to 63.9%/61.5% with previously recognized BTV serotypes and was most closely related to BTV-25 (nucleotype K, Figure 2).
However, BTV RNA was detected in only 2 sheep serum samples (animals 364 and 374), suggesting that the clinical signs were not caused by ongoing BTV infection.
BTV RNA was detected by using a BTV Seg-10-specific rRT-PCR (8) previously used to detect BTV-25 in Switzerland (15).
At peak viremia, a previously unexposed sheep infected with a virulent BTV strain could be expected to show Ct values -20.
Different isolates of a single BTV serotype show >68.4%/72.6% nt/aa identity in Seg-2/VP2, with 40.5%/ 22.1% to 71.5%/77.8% identity between different serotypes (4).
Her current research interests include characterization of BTV and the molecular epidemiology and diagnosis of BTV infection and other related orbiviruses.
Of the 56 sampled bucks, 51 were BTV-n positive by the BTV group-specific RT-qPCR ([C.sub.t] value range 27.7-37.8).
We report the detection and identification of a new BTV, BTV-n, that is circulating among goats on Corsica.
Comparison of the segment 2 nucleotide sequences of the 26 BTV serotypes enabled definition of 12 nucleotypes; members of the same segment 2 nucleotype are characterized by at least 66.9% identity in their segment 2 nucleotide sequences (7).
positive for BTV-n by RT-qPCR were from healthy bucks, and most BTV samples from clinically affected goats were negative for BTV group by RT-qPCR.
We suggest, on the basis of the following findings, that the newly detected BTV-n strain could be a new serotype: the differences between BTV-n sequences and other BTV sequences were as high as those described by Maan et al.
Primers and probe used to detect the BTV strain BTV-n in samples from goats, Corsica, France, 2014 * Probe and PCR type Target primer names Conventional Segment 2 PF BTV RT-PCR PR Conventional BTV-n segment 2 BTV-n F RT-PCR BTV-n R Real-time BTV-n segment 2 BTV-n F3 RT-PCR BTV-n R3 BTV-n Primer sequence, Nucleotide PCR type 5' [right arrow] 3' location Conventional YRWTTGATTTTGARAARGA 1549-1566 BTV RT-PCR GAAYCGACCACTGCCTATG 2355-2337 Conventional CAGATCTGGTTTTACCGAG 1546-1564 RT-PCR ATGATCCATCGGACTTAACT 1949-1927 Real-time TGGATCATGATGGTTATGAACACC 1942-1966 RT-PCR CGCCTCTCCAATCTCACGTATT 2102-2081 FAM-TGACTATGCGAGGTTGG-MGB 1987-2004 * BTV, bluetongue virus; RT, reverse transcription; PF, forward primer; PR, reverse primer.