CACCT

AcronymDefinition
CACCTChambers Accommodation & Tourism (South Africa)
References in periodicals archive ?
About the CACCT The Collaborative was an outgrowth of the Michigan Peer Review Organization (MPRO) initiative to bring together community organizations to reduce re-hospitalizations of those with high risk, chronic, medical conditions.
CACCT Cumbria The Hare & Hounds, Bowland Bridge hareandhoundsbowlandbridge.
The primers used for real-time PCR assay Target group Forward primer Reverse primer Bacteria (1) CGGCAACGAGCGCAACCC CCATTGTAGCACGTGTGTAGCC Methanogens (2) TTCGGTGGATCDCARAGRGC GBARGTCGWAWCCGTAGAATCC Methanobacteriales (3) CGWAGGGAAGCTGTTAGT TACCGTCGTCCACTCCTT Methanomicrobiales (3) ATCGRTACGGGTTGTGGG CACCTAACGCRCATHGTTTAC Methanosarcinales (3) GTAAACGATRYTCGCTAGGT GGTCCCCACAGWGTACC Methanococcales (3) TAAGG GCTGG GCAAG T CACCT AGTYC GCARA GTTTA Annealing Amplicon temp.