CACG

AcronymDefinition
CACGCollege Access Challenge Grant (US Department of Education)
CACGCompagnie d'Aménagement des Coteaux de Gascogne (French development company)
CACGCatholics in Alliance for the Common Good (Washington, DC)
CACGCackling Goose (bird species)
CACGChronic Angle Closure Glaucoma
CACGCommonwealth Association of Corporate Governance
CACGCentral Asia Consulting Group (Tashkent, Uzbekistan)
CACGConsolidated Alliance Capability Goal (NATO)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
POAG: primary open-angle glaucoma; CACG: chronic angle-closure glaucoma; PACG: primary angle-closure glaucoma; NTG: normal-tension glaucoma.
Aptamer (5'-pyrene-GCG C GGGG CACG TTTA TCCG T CCC TCCTAGTGGCGTGCCCC GCGC-3') was purchased from Biosearch Technologies (Novato, CA).
Upon the suspension of trading on NASDAQ, and pending resolution of the company's appeal to the Listing Council, the company said its common stock, warrants and units will be eligible to trade on the OTC Markets' OTCQB market tier under the ticker symbols CACG, CACGW and CACGU.
CACG systems are always evolving because of theoretical and technological advances, changing consumer needs, and market competition (Sampson et al., 1990).
But most of the work with CACG has been done in residential treatment settings, which are becoming increasingly rare.
Two such organizations are the San Francisco-based Catholics for the Common Good (CCG) and the Washington, D.C-based Catholics in Alliance for the Common Good (CACG).
Myostatin haplotype distribution in different breeds (cross) Non-meat Breeds Double Haplotype Sequence Huyang (71) Kazak (48) Beltex (7) Haplo1 CGAG 23.24 6.25 Haplo2 CGAA 42.88 Haplo3 CGCG 11.27 17.71 Haplo4 CGCA 42.88 Haplo5 CAAG Haplo6 CACG Haplo7 TGAG 23.24 43.75 14.24 Haplo8 TGAA Haplo9 TGCG 42.25 32.29 Haplo10 TGCA / / / Haplo11 TAAG Haplo12 TACG Muscle Meat Breeds Haplotype Bx H (32) Dorper (56) MPMF (127) MF (23) Haplo1 21.88 58.04 39.76 43.48 Haplo2 39.06 Haplo3 17.86 29.53 19.57 Haplo4 10.94 Haplo5 2.76 Haplo6 4.72 Haplo7 21.87 10.71 14.57 10.87 Haplo8 6.25 Haplo9 13.39 4.72 26.09 Haplo10 / / / / Haplo11 0.39 Haplo12 3.54 "/" means haplo10 was not present in the studied sheep populations, and animal numbers are in brackets after the breed.
HPV type hME primer sequence (a) UEP, D (a) Extension EP, Da 16 TTAAAGTTAGTATTTTTATATGTAGT 8 019 T 8 307 18 TATACTGCTTAAATTTGGTAGCA 7 053 T 7 341 31 TTTAAAATTACTACTTTTAAATGTAGT 8 261 AT 8 863 33 TGTCACTAGTTACTTGT 5 166 G 5 480 35 CTAGAAGACACAGCAGAAC 5 824 ACACAG 7 655 39 TCCTCCACGTGCCTGG 4 809 T 5 097 45 CTACTATACTGCTTAAACTTAGTAG 7 615 G 7 928 51 AACCGCAGCAGTGGC 4 587 AG 5 213 52 TGTGCTTTCCTTTTTAACCTCAG 6 947 CACAT 8 440 56 GTCTAAGGTACTGATTAATTT 6 450 T 6 738 58 TGTACCTTCCTTAGTTACTTCAG 6 956 T 7 244 59 TCCTCCACATGTCTGGCA 5 411 T 5 699 66 GGCGAAGGTATTGATTGATTT 6 531 CACG 7 736 68 CTCAACATGCCTAACATATT 6 020 CCT 6 887 (a) All primer sequences are given from the 5' end.
As shown in Table 2, ten patients (0.3%) had chronic angle closure glaucoma (CACG); 237 patients (6.0%) had narrow angle glaucoma (NAG); 151 patients (3.8%) had pigmentary glaucoma (PDS); 1,348 patients (34.0%) had primary open angle glaucoma (POAG); 2,017 patients (50.9%) were glaucoma suspects (GS); 89 patients (2.3%) had pseudoexfoliation glaucoma (PXF); 12 patients (0.3%) had ocular hypertension (OHTN); 28 patients (0.7%) had low tension glaucoma (LTG); 35 patients (0.9%) had neovascular glaucoma (NVG); 20 patients (0.5%) had congenital glaucoma; and 16 patients (0.4%) had juvenile glaucoma.
This list includes the Organization for Economic Cooperation and Development (OECD), the Commonwealth Association for Corporate Governance (CACG), and the International Corporate Governance Network (ICGN).
The OECD Principles on Corporate Governance, the principles developed by the Commonwealth Association for Corporate Governance (CACG), the work developed by the World Bank and by regional forums such as APEC all provide guidance in these areas.