CACT

AcronymDefinition
CACTCarnitine-Acylcarnitine Translocase Deficiency
CACTCitizens Advisory Committee on Transportation (various locations)
CACTConnecticut Association for Community Transportation
CACTCommand Aircraft Crew Training
CACTCommand Air Crew Training
CACTCivil Air Carrier Turbojet
CACTCenter for Advanced Computation and Telecommunications (University of Massachusetts Lowell)
CACTCombined Arms Command Training
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Clinical staff implemented the cACT, ACT, and PEF on patients meeting all inclusion criteria for the study on August 1, 2016.
cACT 1972 SECTION 123 (2A) LAND SITUATE A AT JARVIS ROAD, ERDINGTON IN THE CITY OF BIRMINGHAM NOTICE is hereby given that Birmingham City Council (hereinafter referred to as "the Council") propose to dispose of the land described in the Schedule hereto THE said land is shown edged red on the plan which may be inspected at all reasonable hours at the offices of the undersigned at 10 Woodcock Street, Aston, Birmingham B7 4BL THE Council will consider any objections to the proposal which objections should be made in writing to the undersigned (quoting reference LS/PH/AV/143153) V not later than the 19th March 2015.
In computer-assisted cognitive training (CACT), a computer is used to present exercises; successful completion of these exercises requires maintaining attention in order to respond accurately based on defined rules that require the use of WM capabilities (Rabiner, Murray, Skinner, & Malone, 2010).
Validated instruments to measure asthma control include the Asthma Control Test (ACT), Childhood ACT (cACT), Asthma Control Questionnaire (ACQ), and Asthma Therapy Assessment Questionnaire (ATAQ) (6).
Opuntia bahamana Britton & Rose, Cact. 1: 203, 1919 [C&C], Notes: This species is considered as a synonym of O.
Officials visited Greenwich council to learn more about its unique partnership with Charlton Athletic Community Trust (CACT).
Fredrickson first learned about Harris & Bruno on a class tour organized with help from the Sierra College Center for Applied Competitive Technologies (CACT) in celebration of National Manufacturing Day.
The data set provided included the calendar year each course was taught, the course identifier (department name and course number), the name of the instructor, the mean composite ACT score (CACT) for students enrolled in the course, and the frequency distribution for all end-of-course grades assigned.
AIt is an offence f under the Road Traffif cAct to cause or permit a person to use amotor vehicle without avalid policy of insurance.
Marker name Repeat sequence Primer Sequence (5'-3') HmNS17bT [(CACT).sub.31] F: AGTAAAGTGGCCGGCAATCGG R: GAAAGAATTCCACTGGCCAC HmidPS1.792 [(CA).sub.n] F: TCAATGTAACATGCACACACA R: AGTTTGAGCCTTGTCCTGAAT Marker name [T.sub.A] Accession no.