CAPY

AcronymDefinition
CAPYChild Abuse Prevention Year
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Joshua Capy is director of knowledge management for Clearspire, a national law firm that has broken the mold of the traditional firm model by relying on a sophisticated Web 2.0 IT platform to enable its lawyers to work more closely with clients and with each other, while streamlining the management of the business.
CUADRO 1 Caracterizacion de los cinco marcadores microsatelitales a plicados al grupo muestreado de capibaras en los Llanos Orientales de Colombia TABLE 1 Characteristics of the five microsatellite markers applied to one troop of capybaras sampled in the Colombian Eastern Llanos Locus Secuencia del primer # de alelos Rango de (5'-3') tamano de alelos (pb) Capy 12 TGGGTGCCAGAATGCATAGTC 2 195-197 GCATTGCCACCCCTACCTTA Capy 14 TCATAAAGCTGTCCCACTCTGC 2 285-287 GCTGGAAAGCATAGCTCAAACG Capy 24 TGCAGGGAGCACTTTATCCA 7 145-157 CAAGCTGGGCACAAAAAGGA Capy 25 CAAGCATGTTCCTTTCCCCTTA 3 260-264 TGGAGAGCAGAGGATTAAAAGCA Capy 26 TCTGCTTGGTCCTTCTGTTTGA 2 274-276 TCGCAAGGGGACTCTAGTGTTA Las caracteristicas de esos cinco microsatelites fueron determinadas por Herrera et al.
Capy of Old French Colony Dies," Dallas Morning News, January 10, 1929, 13; "Emile Cretien, Native of Reunion, Dies," Dallas Morning News, April 15, 1931, 7; "Early French Settler's Granddaughter to Wed," Dallas Morning News, January 21, 1934, 3; "First Person Born at La Reunion Dies," Dallas Morning News, July 18, 1936, 12; "Old French Colonist Dies.
These cool tools help the capy nip and gnaw grasses, fruits, and water plants.
In 1983 the coefficients for ln(CAPY), per capita income, are consistently greater than one and statistically significant for total game sales, the Numbers Game, Megabucks, and the Instant Game.
Sin embargo, cualquier alteracion en alguno de ellos, como estres en el organismo, deterioro del ambiente o mutaciones de las cepas patogenas, puede desencadenar enfermedades agudas, que provocan perdidas significativas en la industria (Flegel & Pasharawipas, 1998; Moriarty, 1999; Capy et al., 2000; Spann et al., 2000; Vidal et al., 2001).
Mobile Genetic Elements: Protocols and Genomic Applications Wolfgang J Miller, Pierre Capy, eds.
The list ends in a somewhat unclear verse (26): payasam krsaram mamsam apupas ca vrtha krtah / abhojyas capy abhaksyas ca brahmanair grhamedhibhih.
Miller, Pierre Capy Boston, MA:Kluwer Academic Publishers, 2003.
melanogaster, several morphometrical traits, including body size, ovariole number, and bristle number, exhibit likely adaptive latitudinal clines (Capy et al.