CCAT

Category filter:
AcronymDefinition
CCATCross Cultural Awareness Training (various organizations)
CCATComputer Crash Analysis Tool
CCATCdma Card Application Kit
CCATContiguous Concatenation
CCATCritical Care Air Transport Team (US Air Force)
CCATCampus Center for Appropriate Technology (Humboldt State University; Arcata, CA)
CCATCenter for Commercialization of Advanced Technology (San Diego, CA)
CCATCornell Caltech Atacama Telescope
CCATCore Capacity Assessment Tool (nonprofit assessment tool)
CCATComputer Crash Analysis Tool (software)
CCATCanadian Cognitive Abilities Test
CCATCommunication Climate Assessment Tool (American Medical Association)
CCATChildren's Collaborative Action Team (Belmont, CA)
CCATCommerce Classification Automated Tracking System
CCATCompetition Commission Appeals Tribunal
CCATClearfield City Aquatic Team (Clearfield, UT)
CCATCarver Center for Arts and Technology (Baltimore, MD)
CCATCadet Centre for Adventurous Training
CCATContact Center Applications Team
CCATCommodity Classification Automated Tracking System (US Bureau of Industry and Security)
CCATCritical Care Augmentation Team
CCATCerebrals Cognitive Ability Tests (Cerebrals Society)
CCATCommission Consultative Communale pour l'Aménagement du Territoire (French: Consultative Committee for Municipal Planning; Belgium)
CCATCenter for Community Action & Training
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The data were then coded into emergent themesrelated to CCAT constructs independently.
Shown in Figure 3D and E, the results of qRT-PCR and western blot displayed that CCAT 1 knockdown decreased the expression of VEGF, while the opposite results were observed in pEX-CCAT1 group (P<0.05 or P<0.01).
The 25 m CCAT antenna also uses this kind of segment design.
H3C joins 20 other Gold Members, including 99Cloud, Aptira, CCAT, China Mobile, China Telecom, Cisco, City Network, Dell EMC, Deutsche Telekom, EasyStack, Ericsson, Fujitsu, Hitachi, Inspur, inwinSTACK, Mirantis, NEC, NetApp, UnitedStack and ZTE.
Primer Sequence (5'-3') Reference murA-full (a) F AAACAGCAGACGGTCTATGG [18] R CCAT GAGTTTAT CGACAGAACG glpT-full F GCGAGTCGCGAGTTTTCATTG [18] R GGCAAATATCCACTGGCACC uhpT-full F TTTTTGAACGCCCAGACACC [18] R AGTCAGGGGCTATTTGATGG uhpT-partial F ATGCTGGCTTTCTTAAACC [19] R TTATGCCACTGTCAACTGC uhpA-full F GATCGCGGTGTTTTTTCAG R GATACTCCACAGGCAAAACC [18] uhpA-partial F ATCACCGTTGCCCTTATAGA [19] R TCACCAGCCATCAAACAT ptsI-full F GAAAGCGGTTGAACATCTGG [18] R TCCTTCTTGTCGTCGGAAAC cyaA-full F AACCAGGCGCGAAAAGTGG [18] R ACCTTCTGGGATTTGCTGG rpoD-qPCR F CAAGCCGTGGTCGGAAAA [20] R GGGCGCGATGCACTTCT uhpT-qPCR F AAGCCGACCCTGGACCTT [20] R ACGGTTTGAACCACATTTTGC (a) Primers designated "full" were used for direct sequencing, and "qPCR" were used for real-time RT-PCR.
The other studied the combination of CCAT and HOTAIR.
"With the under-representation of women in manufacturing, sparking interest in future careers among girls is a priority to assure that manufacturers can attract, retain and advance women in leading, skilled positions," said Susan Palisano, director of education and workforce development for the Connecticut Center for Advanced Technology (CCAT), which licenses and directs Connecticut.
"We decided to come up here and see if there were opportunities to help New Hampshire manufacturers," said Don Balducci, director of CCAT's Advanced Manufacturing Center.
TUNIS, (TAP) - President of the Centre for Conciliation and Arbitration of Tunis (French: CCAT) Chawki Tabib warned against the misuse of arbitration, mediation or conciliation in the transitional justice process.
We use "topic codes" set, which include four hierarchical groups: CCAT, ECAT, GCAT, and MCAT.