CCR1


Also found in: Medical.
AcronymDefinition
CCR1C-C Chemokine Receptor 1 (gene)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The CPA pronoun usually precedes the Participle, but occasionally occurs after it (for example, Matt 21:26 CCR1 [phrase omitted]).
Inflammatory cytokines are secreted by inflammatory cells including TNF-[alpha], IL-1, IL-6, IL-8, NF-[kappa]B, MCP-1, leptin, CCR1, MIF, and COX-2.
Major signaling pathways and effectors in liver fibrosis Pathway Effectors Growth factor signaling PDGF, TGF-[alpha], EGF, VEGF Fibrogenic signaling pathway TGF-[beta]1 Chemokine pathways CCR5, CCR1, CXCL4, CXCL9, CXCR3 Adipokine pathways Leptin, adiponectin Neuroendocrine pathways Cannabinoid and opioid signaling, thyroid hormones, serotonin CCR: C-C chemokine receptor; CXCL: CXC chemokine ligand; CXCR: CXC chemokine receptor; EGF: epidermal growth factor; PDGF: platelet-derived growth factor; TGF: transforming growth factor; VEGF: vascular endothelial growth factor
Gene Forward (5' [right arrow] 3') Cxcr2 atccaccttgaattctcccatc Il6ra cctctgacttccatttctgct Cxcr1 tcccgtgatatttccaaattctttc Ccr3 ggtgcccactcatattcatagg Ccr5 gtgctgacataccataatcgatg Ccr1 aggaactggtcaggaataatagc Gpr75 tcaggatctcagctcacaga Ccr2 actgaggtaacatattattgtcttcca Cx3cr1 cacaatgtcgcccaaataacag Cyclophilin tggagagcaccaagacagaca Gene Reverse (5' [right arrow] 3') Product length (bp) Cxcr2 gcctcactttcttccagttca 145 Il6ra caagaatcctcgtccatgtcc 118 Cxcr1 tcccgcacacaaggaac 120 Ccr3 ctactggactcataaaggacttagc 125 Ccr5 tgtcttcatgttagatttgtacagc 147 Ccr1 caaaggcccagaaacaaagtc 125 Gpr75 agatagggtcactactgcga 102 Ccr2 gagccatacctgtaaatgcca 148 Cx3cr1 tcccttcccatctgctca 112 Cyclophilin tgccggagtcgacaatgat 66 Table 2: Cytokines/chemokines receptors name and its ligands.
(a-d) mRNA expression of C-C chemokine receptors (CCRs) that can potentially bind CCL2 (i.e., CCR2, CCR1, CCR4, and CCR10), normalized to the ABELSON housekeeping gene (ABL1).
Autocrine regulation of re-epithelialization after wounding by chemokine receptors CCR1, CCR10, CXCR1, CXCR2, and CXCR3.
Global Markets Direct's, 'C-C Chemokine Receptor Type 1 (HM145 or LD78 Receptor or Macrophage Inflammatory Protein 1-Alpha Receptor or CD191 or CCR1) - Pipeline Review, H1 2016', provides in depth analysis on C-C Chemokine Receptor Type 1 (HM145 or LD78 Receptor or Macrophage Inflammatory Protein 1-Alpha Receptor or CD191 or CCR1) targeted pipeline therapeutics.
CCR1, CCR3, and CCR4 were up-regulated when PBMC was co-cultured with UL128 at low concentration (10 ng/mL).
CC chemokine ligand 3 attracts different immune cells, including T lymphocytes, to sites of inflammation through activation of the chemokine receptors CCR1 and CCR5.
Nemoto-Sasaki et al., "Potential interaction between CCR1 and its ligand, CCL3, induced by endogenously produced interleukin-1 in human hepatomas," American Journal of Pathology, vol.
[GO.sub.TMF] terms unique to superkingdoms started to appear late in evolution (nd > 0.4), first in Bacteria at nd = 0.41 ("chorismate lyase activity [GO: 0008813]"), then in Eukarya at nd = 0.45 ("CCR1 chemokine receptor binding [GO: 0031726]"), and finally in Archaea at nd = 0.47 ("methylenetetrahydromethanopterin dehydrogenase activity [GO: 0030268]") (Figure 3(b)).
The expression of chemokines receptors CCR1 and CCR2 in CD14+ CD16+ monocytes appeared to be increased by 3.5 and 2.2 times, respectively, in patients with neovascular ARMD [81].