CCR3


Also found in: Medical, Wikipedia.
AcronymDefinition
CCR3C-C Chemokine Receptor 3
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
(24.) There are at least 46 instances of [phrase omitted] as a present tense copula translated by the CPA pronoun in tripartite nominal clauses (Mt 2:2 CCR3; 22:42 CCR1; 23:8a CCRI, [CSROc]; 23:8b [CSROe]; 23:9 CCR1, [CSROe]; 23:10 CCR1, [CSROe]; 23:17 CCR1; 24:5 [CSROe]; 24:45 CCRI.
Tanaka et al., "Narcolepsy susceptibility gene CCR3 modulates sleep-wake patterns in mice," PLos One, vol.
Eotaxin-2 is a potent chemoattractant that binds to CCR3 for intracellular messaging.
Gene Forward (5' [right arrow] 3') Cxcr2 atccaccttgaattctcccatc Il6ra cctctgacttccatttctgct Cxcr1 tcccgtgatatttccaaattctttc Ccr3 ggtgcccactcatattcatagg Ccr5 gtgctgacataccataatcgatg Ccr1 aggaactggtcaggaataatagc Gpr75 tcaggatctcagctcacaga Ccr2 actgaggtaacatattattgtcttcca Cx3cr1 cacaatgtcgcccaaataacag Cyclophilin tggagagcaccaagacagaca Gene Reverse (5' [right arrow] 3') Product length (bp) Cxcr2 gcctcactttcttccagttca 145 Il6ra caagaatcctcgtccatgtcc 118 Cxcr1 tcccgcacacaaggaac 120 Ccr3 ctactggactcataaaggacttagc 125 Ccr5 tgtcttcatgttagatttgtacagc 147 Ccr1 caaaggcccagaaacaaagtc 125 Gpr75 agatagggtcactactgcga 102 Ccr2 gagccatacctgtaaatgcca 148 Cx3cr1 tcccttcccatctgctca 112 Cyclophilin tgccggagtcgacaatgat 66 Table 2: Cytokines/chemokines receptors name and its ligands.
The report provides comprehensive information on the C-C Chemokine Receptor Type 3 (C-C CKR-3 or Eosinophil Eotaxin Receptor or CD193 or CCR3), targeted therapeutics, complete with analysis by indications, stage of development, mechanism of action (MoA), route of administration (RoA) and molecule type.
These cytokines stimulate the generation of eotaxin, which acting on CC chemokine receptor 3 (CCR3) on eosinophilsthen stimulate the migration of eosinphils into the lung tissue.
Cloning and functional characterization of a novel human CC chemokine that binds to the CCR3 receptor and activates human eosinophils.
Kleinman et al., "CCR3 is a target for age-related macular degeneration diagnosis and therapy," Nature, vol.
CCR1, CCR3, and CCR4 were up-regulated when PBMC was co-cultured with UL128 at low concentration (10 ng/mL).
EOS is thought to be recruited to tumours, by selective EOS chemoattractant eotaxin, which binds to CCR3 receptor on these cells.
The characteristic chemokine receptor on Th2 cells is CCR3, the eotaxin receptor.