CCY

AcronymDefinition
CCYCurrent Calendar Year
CCYCurrency
CCYClock Cycle
CCYCollectif Cheikh Yassine (French Muslim political organization)
CCYCompacted Cubic Yard (measurement)
CCYCochran, Cochran & Yale (Rochester, NY)
CCYCholecystectomy
CCYCamping Club Youth (UK)
CCYCommission on Children and Youth
CCYCommunity Coalition for Youth (Lansing, MI)
CCYCentre for Children and Youth (est. 1997; University of Northampton; Northampton, UK)
CCYclean cut youngers (UK band)
CCYClub Canin Yonnais (French dog club)
CCYChief Communications Yeoman (UK Royal Navy)
CCYClub des Collectionneurs des Yvelines (French: Collectors Club of Yvelines; Yvelines, France)
References in periodicals archive ?
* Adjusted EBITDA margin1 increased 2.8ppt to 40.0% on a CCY basis.
(17.) Sridhar S, Yip CCY, Wu S, Cai J, Zhang AJ, Leung KH, et al.
Canthon euryscelis (Bates 1887) (1,3) (Ce) Canthon cyanellus (Le Conte 1859) (1,2) (Ccy) Canthon indagaceus chevrolati (Harold 1868) (3) Deltochilum gibbosum sublaeve (Bates) 1887 (1,2) (Dg) Deltochilumpseudoparile (Paulian 1838) (1,2) (Dp) Deltochilum scabriusculum scabriusculum (Bates 1887) (1) (Ds)
News: The Central Bank of the Republic of Turkey has published its regular weekly statistics: lending growth accelerated to 24.8% YoY and outflows from the local ccy government bond market reached USD 1,098mn (USD 1,511mn for the last four weeks) while out of equities they were USD 145mn (inflows of USD 536mn for the last four weeks).Our View: The Turkish financial market saw outflows of USD 145mn from the equity market and USD 1,098mn from government bond securities in the week ending 31 May.
Nekooeian, AA., Panz CCY., 1998, Estrogen Restores Role of Basal Nitric Oxide in Control of Vascular Tone in Rats with Chronic Heart Failure.
This research was completed by an interdisciplinary research team from the University of Northampton's Centre for Health and Well-being Research (CHWR; School of Health) and Centre for Children and Youth (CCY; School of Social Sciences).
At the end of the fattening period, 24 male birds (4x3x2) with 2054 g ([+ or -] 80 g) body weight were slaughtered following a 16 hours water deprivation to measure hot and chilling carcass yields (HCY and CCY in %) and proportions of breast (BY) (%) and thighs (TH) (%).
[Payoff.sub.CCY](T) t o payoff que occorre em T na moeda CCY especificada no subscrito;
A 459 base-pair (bp) fragment of the mitochondrial cytochrome c oxidase subunit I (COI) gene region (F: 5'CTTTCGGCTACATGGGAATG3' and R: 5'AGCCCTAGGAAGTGTTGTGG5', GenBank accession number DQ867533), a 535-bp fragment of the mitochondrial control region (Pro-F: 5' CTA CCY CYA ACT CCC AAA GC 3', [Gray et al., 2008] and Phe-R: 5' GTA AAG TCA CGA CCA AAC C 3', [Brendtro et al., 2008], and eight microsatellite loci Asa2, Asa4, Asa16, [Brown et al., 2000]; Aa16, [Faria et al., 2004]; AsaB020, AsaC334, AsaD055, [Julian and Bartron, 2007]; SarBH04, [Pereyra et al., 2004]), were amplified in either 5-[micro]L (microsatellites) or 10-[micro]L (COI) reaction volumes using the polymerase chain reaction (PCR) with the conditions outlined in Lynch (2008).
Chamberlin, TW, Cheung, CS and Kwan, CCY. 1989: Expiration day effects of index futures and options: Some Canadian evidence.