CIBN

AcronymDefinition
CIBNChristian International Business Network
CIBNCommunity Impacting Business Network (Christian organization)
References in periodicals archive ?
On the basis of these signatures, CIBN also attributes a uniform early provenance to all five texts in Res D.
In what follows, I look more closely at the provenance information suggested by CIBN for Res D.
SCOGA, a not-for-profit gamers association comprising veteran gamers, will work with CIBN to promote games under the Singapore Game Box to Chinese gamers through CIBN's platforms.
In addition, the CIBN has started a campaign to ensure ethical and professional practice as well as the provision of training.
Los temas de investigacion en el CIBN abarcan tambien temas de bioquimica clinica.
CIBN is the sole accreditation agency under the Competency Framework for the country's Banking and Finance industry.
En el estudio para conocer la produccion de cada docente-investigador, entre los anos 2004 y 2009, a traves de una Ficha de Registro del Investigador -2009 disenada para la tarea, contesto la mitad de los miembros permanentes de 5 Institutos y el CIBN, en proporciones diferentes, no habiendose recibido respuestas del Instituto de Investigacion de Cirugia Esperimental.
Se determino los genotipos de la enzima COMT con la tecnica RFLP (digestion con enzima NlaIII), despues de amplificacion por PCR con primers especificos (Comt 1: 5' CTCATCACCATCGAGATCAA 3' y Comt 2: 5' CCAGGTCTGACAACGGGTCA 3'), segun lo informado por Egan (12), Malhotra (13) y Lachman (17) y estandarizada de acuerdo a las condiciones del laboratorio de Biologia Molecular, CIBN, Facultad de Medicina, UNMSM.
Nasdaq:VAST), the worldwide leading provider of solutions for Global Trade Management (GTM), today announced that leading chemical manufacturer Ciba Specialty Chemicals (SWX: CIBN, NYSE: CSB), has implemented Vastera's TradeSphere Importer, Exporter and Customs Manager solutions.
Ciba Specialty Chemicals (SWX: CIBN, NYSE: CSB) is a leading company dedicated to producing high-value effects for its customers' products.
Headquartered in Beijing, CIBN provides one-stop broadband services to enterprise and individual clients based on a nationwide CATV backbone network operating from data centers in 16 Chinese provinces.
Sunny Kuku, urged that the CIBN make it mandatory for banking professionals to have CIBN certification to operate in the banking industry.