CNF1

AcronymDefinition
CNF1Cytotoxic Necrotizing Factor-1
References in periodicals archive ?
Primers used in PCR to amplify specific fragments from genes for CNF1, CNF2, Bfp, LT, ST, Stx1, Stx2, and eaeA Gene Primer Oligonucleotide sequence (5'-3') CNF1 CNF 1a GCTAACGAGACTATGCTCTG CNF 1b ACGCTGCTAAGTACCTCCTGG CNF2 CNF 2a GCAGAATTTGATACACGAATGATG CNF 2b GCATTTGGCTATGAATCAATATTTC BFP BFPa AATGGCGCTTGCGCTTGTTGC BFPb GCCGCTTTATCCAACCTGGTA LT LTa TCTCTATGTGCATACGGAGC LTb CCATACTGATTGCCGCAAT ST STa TTAATAGCACGCGGTACAAGCAGG STb CTTGACTCTTCAAAAGAGAAAATTAC Stx1 stx1a CAGTTAATGTGGTGGCGAAG stx1b CTGCTAATAGTTCTGCGCATC Stx2 stx2a CTTCGGTATCCTATTCCCGG stx2b CTGCTAATAGTTCTGCGCATG eaeA eaeAa GGCTCAATTTGCTGAGACCACGGTT eaeAb GCAAATTTAGGTGCGCGTCAGCGTT Gene Size of amplified Reference product (bp) CNF1 278 Falbo et al.
CNF1 and CNF2 share 99% amino acid similarity; however, we will discuss only CNF1 in detail because of its association with extraintestinal E.
The gene for CNF1 is chromosomally encoded and resides on a pathogenicity island in uropathogenic E.