COL1A1


Also found in: Medical, Wikipedia.
AcronymDefinition
COL1A1Collagen, Type I, Alpha1
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Entre tanto, en las pruebas moleculares del gen COL1A1 fue necesaria la amplificacion de sondas dependiente de ligandos multiples, usando un kit comercial (Invitrogen, Carlsbad, Estados Unidos) bajo las recomendaciones del proveedor o el protocolo de RT-PCR cuantitativa y la secuenciacion del gen por el metodo de Sanger para la deteccion de mutaciones puntuales (figuras 3a y 3b).
To confirm the differentiation of cells, both cell types were labeled with specific antibodies against markers of osteogenic (COL1A1, OCN), chondrogenic (COL2A1), and adipogenic (FABP4) cell types.
2: Primer sequences Gene Forward primer sequence Reverse primer sequence ACTA2 CTGACCCTGAAGTACCCGATA GAGTGGTGCCAGATCTTTTCC COL1A1 AGATCGAGAACATCCGGAG AGTACTCTCCACTCTTCCAG GAPDH ATCTTCTTTTGCGTCGCCAG TTCCCCATGGTGTCTGAGC IL1B TGGGTAATTTTTGGGATCTACACTCT AATCTGTACCTGTCCTGCGTGTT IL6 AGCCCACCGGGAACGA GGACCGAAGGCGCTTGT IL8 AGAAGTTTTTGAAGAGGGCTGAGA CAGACCCACACAATACATGAAGTG PLOD2 AAGACTCCCCTACTCCGGAAA AGCAGTGGATAATAGCCTTCCAA SERPINE1 GTCTG CTGTGCACCATCCCCCATC TTGTCATCAATCTTGAATCCCATA TNF TCTTCTCGAACCCCGAGTGA CCTCTGATGGCACCACCAG
Experimental murine myopia induces collagen type I[alpha]1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera.
In rat mesangial cells, TGF-[beta] increased profibrotic genes such as Col1a1 and PAI-1, associated to increased H3K4me mark levels [114].
Collagen type I was recognized by anti-human COL1A1 goat primary antibody and relative FITC-conjugated secondary antibody (donkey anti-goat IgG-FITC); collagen type III was identified by anti-human COL3A1 goat primary antibody and relative rhodamine-conjugated secondary antibody (bovine anti-rabbit IgG-R).
The secreted TGF-[beta] has a direct correlation with the expression of a-Smooth Muscle Actin ([alpha]-SMA) and Col1A1 [12, 13].
Other genes that were upregulated in great abundance encode collagen (COL3A1, COL1A1), light chain of myosin (MYL7), metallopeptidase (MMP2), and so forth.
(1) Gene expression analysis Excellent osteogenic potential of sprayed CaP (i) Day 7: Runt-related and WJ-MSCs in bone transcription factor 2 (RUNX2) and tissue engineering secreted phosphoprotein 1 (SPP-1) were upregulated (ii) Day 14: collagen type 1 Alpha 1 (COL1A1) and ALP were upregulated (iii) Day 21: bone gamma- carboxyglutamic acid-containing protein (BGLP) and ALP were upregulated (2) Nodule characterization (i) Hematoxylin-eosin-saffron (HES) staining revealed continuous layers of cells at the surface of the nodule with randomly distributed cells embedded within fibrous tissues (ii) Masson's trichrome staining showed the presence of green- stained fibrous tissue composed of newly formed collagen 7.
Recent studies have indicated that Egr1 plays a crucial role in the pathogenesis of renal fibrosis by activating the promoters of collagen 1[alpha]1 (COL1A1), cartilage oligomeric matrix protein (COMP), periostin, matrix metalloproteinase 2 (MMP2) [11], tissue metallopeptidase inhibitor 1 (TIMP1), and osteopontin (OPN).
The list includes candidate genes such as TGIF (MYP2), LUM (MYP3), COL1A1 (MYP5), IGF-1, PAX6 and SOX2, BICC1, and RASGRF1.
Two decades ago when relevant biochemical and molecular technology became available, involvement of the COL1A1 and COL1A2 genes was excluded and it was suggested that in this AR form of OI, genes that controlled the processing of type I collagen may have been involved.