COL1A2


Also found in: Medical.
AcronymDefinition
COL1A2Collagen, Type I, Alpha2
References in periodicals archive ?
La amplificacion se realizo por RT-PCR utilizando los cebadores TGF-P1 (for GGCAGCTGTACATTGACTTCC, rev CCTTGCTGTACTGCGTGTCC), COL1A2 (for CTGGTAGTCGTGGTGCAAGT, rev AATGTTGCCAGGCTCTCCTC), MMP-20 (for TCGAGGTGGACAAAGCAGTG, rev TGGGCTTCCCCAGGAATACT), y GUSB (for ATCACCGTCACCACCAGCGT, rev GTCCCATTCGCCACGACTTTGT) (Operon-Eurofins, Huntsville, AL, USA) como gen control.
Osteogenesis imperfecta type III: Mutations in the type I collagen structural genes, COL1A1 and COL1A2, are not necessarily responsible.
Our results corroborate these findings as we observed an increase in gene expression of LTPB1, TGFpl, SMAD2, SMAD4, COL1A1, COL1A2, COL6A3, MMP1, MMP2, MMP3, and MMP4.
The PCR analysis of the expression of COL10A1 and COL1A2 generated similar results.
The most important genes clustering CTCs in the subgroups were cadherin 2 (CDH2), collagen type I alpha 2 chain (COL1A2), collagen type V alpha 2 chain (COL5A2), fibronectin 1 (FN1), microtubule associated protein 1B (MAP1B), matrix metallopeptidase 3 (MMP3), SRY-box 10 (S0X10), secreted phosphoprotein 1 (SPP1), zinc finger E-box binding homeobox 1 (ZEB1), and zinc finger E-box binding homeobox 2 (ZEB2; Fig.
However, miR-29b acted as a protective regulator by targeting COL1A1 and COL1A2 , leading to the deactivation of ECM production.[sup][20] UnlikemiR-21, miR-146a targeted Smad4 in TGF-[sz]-stimulated HSCs, deactivating both HSCs and human dermal fibroblasts.[sup][37],[38] In addition to Smad7 and Smad4 , Smad3 was also a fibrotic miRNA target.
A study conducted at the Leibniz Research Institute for Environmental Medicine (IUF) and published in Skin Pharmacology and Physiology in 2012 found that Pycnogenol: elevated new endogenous collagen production by increasing gene expression of COL1A1 by 29% and COL1A2 by 41%; increased hyaluronic acid production in skin by increasing gene expression of hyaluronic acid synthase by 44%; enhanced skin elasticity by 25%; improved skin hydration by 21%; and decreased skin fatigue by 30%.
THSG reduces intima-media thickness in the aortic arch of SHRs, increases the vascular diastolic rate in response to acetylcholine, and reduces remodeling and fibrosis-related mRNA expression, such as that of genes ACTA2, CCL3, COL1A2, COL3A1, TIMP1 WISP2, IGFBP1, ECE1, KLF5, MYL1 BMP4, FN1, and the plasminogen activator inhibitor-1 (PAI-1).
The genes CoL1A2, COL3A1, CoL6A1, COL6A3 and COL7A1 have been identified as definite TGF-[beta] targets which are induced in fibroblasts at early stages of the disease.
This analysis revealed three top-ranking pathways, which are listed in their respective order: complement and coagulation cascades (14 downregulated genes in the H group), systemic lupus erythematosus (14/16 downregulated genes in the H group) and ECM -receptor interactions (7 downregulated genes, including collagen, type IV, alpha 6 (COL4A6), tenascin C (TNC), secreted phosphoprotein 1 (SPP1), collagen, type I, alpha 2 (COL1A2), COL1A1, CD44 molecule (CD44), and ribosomal protein L26 (RPL26), and 5 upregulated genes, including integrin, beta 6 (ITGB6), syndecan 4 (SDC4), agrin (AGRN), thrombospondin 4 (THBS4), BT.3034.
Pathway term P Genes FDR hsa04510: focal 1.28E-02 ACTB, VWF, ITGAV, 13.35 adhesion MAPK3, COL1A2, PRKCB hsa04650: natural 1.38E-02 MAPK3, PPP3R1, HLA-B, 14.35 killer cell mediated HLA-E, PRKCB cytotoxicity hsa05010: Alzheimer's 2.70E-02 NDUFS5, NDUFA9, MAPK3, 26.32 disease PPP3R1, CDK5 hsa04930: type II 4.32E-02 PRKCZ, MAPK3, CACNA1A 38.89 diabetes mellitus The four highest-ranked terms showing significant differential expression are listed.
Similar tooth structure alterations can sometimes be seen in conjunction with osteogenesis imperfecta (osteogenesis imperfecta with opalescent teeth), but this disorder is associated with mutation of the COL1A1 or COL1A2 gene, (19) making it a disease that is genotypically distinct.