CPV2

AcronymDefinition
CPV2Canine Parvovirus Type-2
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Feline parvo or panleukopenia may have mutated through some other species, particularly wildlife, while becoming CPV2. The various forms of parvovirus are species specific.
This study, therefore, has been conducted to set apart canine parvovirus CPV2 and CPV2b using haemagglutination (HA) test and PCR from fecal samples of the infected dogs.
For CPV2, sense (5'GAAGAGTGGTTGTAAATAATA3') and anti-sense (5'CCTATATCACCAAAGTTAGTAG3') primers were at 3025-3045 and 3685-3706 of the CPV2 genome, respectively that yields a 681 bp product, while sense (5'CTTTAACCTTCCTGTAACAG3') and antisense (5'CATAGTTAAATTGGTTATCTAC3') primers for CPV2b were located at 4043-4062 and 4449-4470, respectively that yields a 427 bp product.
To confirm parvovirus induced HA, all the samples were processed for PCR based amplification resulting in capsid gene amplification from 29 and 27 samples for CPV2 and CPV2b, respectively.
(2001) have reported lack of HA activity among CPV-2 strains, nevertheless, in this study all HA negative samples were found negatve through PCR for either CPV2 or CPV2b gene amplification.
Moreover, the primer pair used for identification of both the CPV2 and CPV2b was highly sensitive and specific (Parrish et al.