CTATCognitive Tutor Authoring Tools
CTATControlled Technology and Transfer (Canadia)
CTATComplementary to Absolute Temperature
CTATCenter for Technical Assistance and Training (Colorado)
CTATComputerized Transverse Axial Tomography
CTATCable Twist Accuracy Technology (performance measurement equipment)
CTATCapillary Tube Agglutination Test
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The highest Days on Market averages were inAugusta, MEat 120,Trenton, NJat 113, andHartford, CTat 96.
CTAT membership consists of secondary and postsecondary career and technical education administrators, counselors and regional education service center CTE specialists.
RW30 [(CTAT).sub.11] GU969043 RW44 [(CTAT).sub.21] GU969044 RW48 [(CTAT).sub.12] GU969045 RW39 [(CTAT).sub.20] GU969046 RW28 [(CTAT).sub.11] CU969047 RW33 [(CTAT).sub.13] GU969048 [T.sub.a] Size range Locus Primer sequences (5'-3') ([degrees]C) (bp) RW30 F: GTTGCGTCAGACATTCAACG 55 97-153 R: CGAGAGCTAGCCACTCAAGG RW44 F: CCATCAAGCCTAATOIXUCA 55 328-448 R: GGTAGGAGAGAGGGAGGGAGA RW48 F: GGCCTACATAAGTGAACTAGAA 55 182-246 R: TGAGGAGAACACAACCCTCA RW39 F: CCATAAGGTTGAAATGAAGAAAAA 55 129-207 R: GTTGATTGATCGTTGGTTGG RW28 F: GATAGATAAATAGATGGATAG 55 186-240 R: TTTTTAAGGTTTCATGGATAAGTACAA RW33 F: GTCCCCCTTAACAAGCATCA 55 180-412 R: CGCGGGTGAATAGATCAGAG Numbers of individuals with No.
The Cognitive Tutors Authoring Tool (CTAT) has been used to develop example-based tutors for genetics, Java, and truth tables (Koedinger, Aleven, Heffernan, McLaren, & Hockenberry, 2004).
The two projects I can feel it in my Tangles and Varia 'tio dele 'ctat are series in which the artist explores the fragility of porcelain against a robust context.
Among ITSs that share our goal of simplifying course development, an interesting example is the Cognitive Tutor Authoring Tools (CTAT) project.
In the meantime, Balzac is more interested in the "ctat auquel l'homme actuelpeutatteindre parson effort personnel, en developpant ce qui est encore en lui a l'etal tarvaire" (236).
The linking oligomer for the naphthalocyanine sensitizer particle to the internal control sequence was IC [5'-GAC AGT GTA GAT AGA TGA CAG TCG [(CTAT).sub.5],-X-3'].