CTGT

AcronymDefinition
CTGTCellular Tissue and Gene Therapies
References in periodicals archive ?
HNL will retain CTGT's facility in Allentown, and all CTGT employees have been offered permanent positions with HNL.
The research first assigned 3-base units to letters of the alphabet, numerals, and punctuation marks [12], see table 2, then it used the encryption key to encode a message reading "JUNE6_INVASION:NORMANDY" as a sequence of 69 bases and synthesized the following DNA strand: AGT CTGT CT GGCTT AAT AATGT CTCCTC GAACGATGGGATCTGCTTCTGGATCATCCCGA TCTTTGAAA.
of Microsatellite Repeat sequence alleles Sca-14 [(CA).sub.6] TA [(CA).sub.13] 5 Sca-23 [(CA).sub.4] AAC [(AG).sub.12] 24 Sca-37 [(TG).sub.8] AG [(TG).sub.4] AG [(TG).sub.4] 9 Sca-44 [(CTCG).sub.2] CTAT [(CTGT).sub.5] 8 Sca-49 [(TG).sub.17] 15 Sca-61 [(CA).sub.6] TGTA [(CA).sub.8] 6 Sca-65 [(TG).sub.13] 24 Microsatellite Average heterozygosity [+ or -] SE [P.sub.HW] (1) Sca-14 0.474 [+ or -] 0.016 0/20 Sca-23 0.803 [+ or -] 0.105 4/20 (2) Sca-37 0.509 [+ or -] 0.014 0/20 Sca-44 0.677 [+ or -] 0.014 0/20 Sca-49 0.656 [+ or -] 0.018 0/20 Sca-61 0.311 [+ or -] 0.018 0/20 Sca-65 0.798 [+ or -] 0.016 0/20 (1) Proportion of samples where P < 0.05, after Bonferroni correction.