CYPA


Also found in: Medical.
AcronymDefinition
CYPAChild and Youth Program Assistant (various armed forces)
CYPACyclophilin A
CYPAChildren and Young Person's Act (Australia)
CYPACommunity Youth Provisions Association (UK)
References in periodicals archive ?
The Cyclophilin A (CypA) is conventional protein reported in bacteria, fungi, plants and mammals (Galat, 1999).
The CypA plays momentous task in protein folding, trafficking, assembly, cell signaling, apoptosis, resisting multifarious environmental stress, inflammation, auto- immune disease, rheumatoid arthritis, pathogenesis, vascular disease, hepatitis B and C and atherosclerosis.
De estas drogas solo el alisporivir (inhibidor de la ciclosporina A, CypA) se encuentra en fase clinica III, los demas estan en fase I o II.
Table 1 Gene Forward primer NLRP3 5' AGAAGCTGGGGTTGGTGAATT 3' ASC 5' CCCATAGACCTCACTGATAAAC 3' Caspase-1 5' AGGAGGGAATATGTGGG 3' IL-1[beta] 5' TGACCCATGTGAGCTGAAAG 3' TXNIP 5' CTGATGGAGGCACAGTGAGA 3' P2rX7 5' CTACTCTTCGGTGGGGGCTT 3' CypA 5' TATCTGCACTGCCAAGACTGAGTG 3' Gene Reverse primer NLRP3 5' GTTGTCTAACTCCAGCATCTG 3' ASC 5' AGAGCATCCAGCAAACCA 3' Caspase-1 5' AACCTTGGGCTTGTCTT 3' IL-1[beta] 5' AGGGATTTTGTCGTTGCTTG 3' TXNIP 5' CTCGGGTGGAGTGCTTAG 3' P2rX7 5' AACCCTGGTCAGAATGGCAC 3' CypA 5' CTTCTTGCTGGTCTTGCCATTCC 3'
Among these family members, CyPA which is a primarily intracellular protein and the founding number of CyPs is expressed abundantly in all mammalian cell types.
CyPA was reported to be a crucial proinflammatory signaling pathway in monocytes [29, 30].
pallida CypA homolog (ApCypA) and show that CsA inhibits the in vitro isomerase activity of protein extracts from symbiotic A.
In vascular smooth muscle cells, oxidative stress leads to increased expression and secretion of CypA, and the PPIase activity of CypA is necessary for inhibiting NO-induced apoptosis and for activating extracellular signal-regulated kinase (ERK 1/2) (Jin et al., 2000).
Two other mouse housekeeping genes were compared with mGAPDH: cyclophilin A (CypA; accession no.
mGAPDH expression appeared constant when normalized with either the CypA or HPRT1 mouse housekeeping gene and was therefore chosen for all experiments (data not shown).
Selective assay for CyPA and CyPB in human blood using highly specific anti-peptide antibodies.