CO1

(redirected from Cytochrome Oxidase 1)
AcronymDefinition
CO1Cytochrome Oxidase 1
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
KEY WORDS: oyster, Crassostrea sikamea, cytochrome oxidase 1, 16S rRNA, distribution, ocean current, evolution
Phylogenetic tree were reconstructed using 12 SrRNA (12S) gene showing homology of 73% compared with gene bank data while on the basis of cytochrome oxidase 1 (Co1) gene 93% homology were recorded.
hongkongensis CACAGCTCACGCATCCCGGTCCAGC#(T)A 798 28sa1923r Saccostrea CACTTTCATTTCGCCTTTAGGTTTCGAAAG 923 28reverse All 1200 Cytochrome oxidase 1 (COI) gene COforward All COCar183r C.