DCTP


Also found in: Dictionary, Medical, Wikipedia.
Related to DCTP: DCTC, DTCP
AcronymDefinition
DCTPDeoxycytidine Triphosphate
DCTPDotation de Compensation de la Taxe Professionnelle (French: Endowment Compensation of Corporate Taxes)
DCTPDeoxycytosine
DCTPDifferentiated Case Tracking Program (Fairfax County Circuit Court; Virginia)
DCTPDetective Conan Translation Project (anime and manga translation)
DCTPDracula's Curse the Page (game)
DCTPDevelopment Company for Television Programs mbH (Düsseldorf, Germany)
DCTPDevelopmental Certification Test Plan
DCTPDrive Channel Tire Pressure
DCTPDesign, Construction and Technology Plan
References in periodicals archive ?
The reaction mixture containing 2 [micro]g of denatured DNA; 120 [micro]mol/L each of dATP, dCTP, and dGTP; 60 [micro]mol/L dTTP; 60 [micro]mol/L Cy5-dUTP; 50 ng/[micro]L random hexamers; and 50 U of Klenow enzyme (New England Biolabs) in its supplied 1x reaction buffer was incubated at 37[degrees]C for 1-2 h.
We used 5 [micro]L for PCR amplification in a total volume of 27 [micro]L (final concentrations) 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 1.8 mM Mg[Cl.sub.2]; 0.1% Triton X-100; 0.005% gelatin; 70 [micro]M each dATP, dCTP, dGTP, and dTTP; 2.5 U AmpliTaq (Perkin-Elmer); 10 pmol upstream primer; and 10 pmol "extended" downstream primer (T7HT11V; Table 1).
Each reaction contained 50 ng of DNA, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM Mg[Cl.sub.2]; Applied Biosystems, Foster City, CA), 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Roche Diagnostics GmbH), 3 mM magnesium acetate, 1.5 U AmpliTaq DNA polymerase (Applied Biosystems), and 50 ng of each primer URA5 (5'ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3').
SSR analyses were carried out in 20-[micro]L reactions with 60 ng of genomic DNA, 0.15 [micro]M of each primer, 1x Gibco-BRL PCR buffer, 2 mM Mg[Cl.sub.2], 200 [micro]M each of dGTP, dTTP, dATP and dCTP, 0.75 U Taq Polymerase (Gibco-BRL), and 0.5x SCR dye [6% (w/v) sucrose, 100 [micro]M cresol red).
The PCR reactions for MCP-1, RANTES, CCR5, and SDF-1 were carried out in a total volume of 25 [micro]L with 5 [micro]L of extracted genomic DNA; 100 [micro]M each of dATP, dGTP, dTTP, and dCTP; 1.5 mM Mg[Cl.sub.2; 1 U of Taq polymerase; and the two primers, forward and reverse, each at a concentration of 80 nM.
Each reaction contained 5 [micro]L of purified DNA as template in a total volume of 50 [micro]L, as well as 200 [micro]M each deoxynucleoside triphosphate (dNTP) (dATP, dCTP, dGTP, and dTTP), 1.25 units Taq polymerase, and 0.5 [micro]M each of primer.
This mixture was incubated at 70[degrees]C for 10 min and then was mixed with 600 U of SuperScript II reverse transcriptase (Invitrogen BV/NOVEX); 30 units of RNase inhibitor; 50 mM Tris-HCl; 75 mM KCl; 3 mM Mg[Cl.sub.2]; 10 mM dithiothreitol; 0.5 mM each of dATP, dTTP, and dGTP; 0.2 mM dCTP; and 1 mM Cy dye in a final volume of 30 [micro]L.
An Arabidopsis OLD cDNA fragment from the plasmid pF2b (Okuley et a!., 1994) was purified and labeled with [[micro]-32P] dCTP (NEN Dupont, 3000 Ci/mmol, 10 mCi/mL) with a random-priming kit (Pharmacia Biotech, Piscataway, NJ) according to the instructions of the manufacturer.
This corresponded to 1.25 U of AmpliTaq Gold DNA Polymerase; 0.5 U of AmpErase Uracil N-Glycosylase; 200 [micro]M each of dATP, dCTP, and dGTP; 400 [micro]M dUTP; 10x TagMan Buffer A; and 25 mM Mg[Cl.sub.2].
Amplification of bean DNA was performed in a 10-[micro]L volume containing buffer [50 mM KCl, t0 mM Tris-HCl (pH 9.0) 0.1% Triton X-100 (v/v), 1.5 mM Mg[Cl.sub.2]], 200 [micro]M each of dATP, dCTP, dGTP, and dTTP, 0,4 [micro]M primer, 1 unit Taq DNA polymerase, and 20 ng of template DNA.
Protocols that use dCTP require a PCR clean-up step with shrimp alkaline phosphatase to inactivate remaining nucleotides (dCTP) that would interfere with the performance of biotin-dCTP.
Each amplification with STS213 primers consisted of 1 to 5 mg rice DNA in a mixture containing 10 mM Tris-HCl, pH 8.2; 50 mM KCl; 100 [micro] M each of dATP, TTP, dCTP, dGTP; 2 MM Mg[Cl.sub.2]; 400 nM of each primer, STS213f and r; and 1 U Taq DNA polymerase per 25-[micro]L reaction volume.