DGAT

AcronymDefinition
DGATDirection Générale de l'Aménagement du Territoire (French: General Directorate of Spatial Planning; various locations)
References in periodicals archive ?
Ours are some of the first findings showing that the two DGAT enzymes are not equal," says Shockey.
DGAT is involved in intestinal fat absorption, lipoprotein assembly, regulation of plasma TG concentration, fat storage in adipocytes, and energy metabolism in muscle.
DGAT is a microsomal enzyme expressed in the liver and rate-limited enzyme in the process of TG synthesis, catalyzes the final step in TG synthesis by converting diacylglycerol and fatty acylcoenzyme A into TC (Farese et a).
In this study, the effects of osthol on PPAR[alpha] and PPAR[alpha]-mediated genes such as DGAT, HMG-CoA reductase, and CYP7A were investigated in vivo and in vitro.
RT-PCR was used to measure the mRNA expressions of PPAR[alpha], DGAT, HMG-CoA reductase, CYP-7A and GAPDH in mouse hepatic tissue.
2007) 5' TCAGAGGTCCCTGAACGGTG 3' DGAT (Okamoto et 5' TGGTCCCTACTATCCAGAACTCCA 3' 492 60 [degrees]C al.
To investigate whether regulation of DGAT, HMG-CoA reductase and CYP7A mRNA expressions by osthol was associated with PPAR[alpha], MK886, a specific inhibitor of PPAR[alpha], was used in the experiment (Kehrer et al.
The expression of DGAT mRNA in mouse liver tissue was significantly increased in model group (p < 0.
Effects of PPAR[alpha] inhibitor MK886 on mRNA expressions of DGAT, HMG-CoA redcutase and CYP7A in cultured BRL cells
4, after pretreatment of BRL ceils with MK886 for 2 h, the inhibition of DGAT and HMG-CoA reductase mRNA expressions by osthol was completely cancelled, but effects of MK886 itself on DGAT and HMG-CoA reductase mRNA expressions were not found.
Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking Dgat.