DSED

AcronymDefinition
DSEDDisinhibited Social Engagement Disorder (psychology)
DSEDDépartement des Statistiques, des Études et de la Documentation (French: Department of Statistics, Studies and Documentation)
DSEDDakota Southeastern Division (National Model Railroad Association)
DSEDDatabase for Sediment Early Diagenesis
DSEDDiagnostic Survey for Eating Disorders
DSEDDefense Sciences Engineering Division (Lawrence Livermore National Laboratory; US Department of Energy)
DSEDDiplôme d'Etudes Superieures de Design (French: Higher Education Design Diploma)
DSEDDirect Support Engineering Directorate
DSEDDelta Squadron Elite Dictatorship (gaming)
DSEDDraft Supplemental Environmental Document (California)
DSEDDistance of Surface Energy Density Fields
References in periodicals archive ?
Development SREM, SADT process process software DSED, JSP (1968-1982) engineering Formal Ensure correctness.
Restriction SNP Primers Sequence (5' to 3') endonucleases TNFRI--609 G/T, Forward CGGACGCTTATCTAT ATCTC Bst4C I rs4149570 Reverse TTGTAGTCCAGTCACAAGCA TNFRI--1207 C/G, Forward TTGGGAGATGTCTGCATCAA BstC8 I rs4149569 Reverse TTCTTCGTTTGCTTGTTTTTCA TNFRII--1709 A/T, Forward GAGTGCTGAGTGAGAAACTG DseD I rs652625 Reverse AGCTTGAATTCGTTCCCAGG TNFRII--3609 C/T, Forward ATGCTTTTGTCCATGCAGGT Msp I rs590368 Reverse GCTGTACCCCGTATTAGCTG SNP: single nucleotide polymorphism; TNFR: tumor necrosis factor receptor.