EFAA

AcronymDefinition
EFAAAavahelukka (airport code; Finland)
EFAAEmergency Family Assistance Association (Boulder County, CO area)
EFAAExpedited Funds Availability Act
EFAAExperimental Functional Android Assistant (Spain)
EFAAEuropean Federation of Accountants and Auditors
EFAAEnglish Field Archery Association
EFAAEagle Football Alumni Association (Georgia Southern University)
EFAAEnglish Family Accommodation Agency (UK)
EFAAExamen Fin Apprentissage Artisanal (French: Final Exam Learning Skills)
EFAAEuropean Fly Fishing Association
EFAAEmergency Food Assistance Act of 1983
EFAAEuropean Federation of Auctioneers-Appraisers
EFAAExponent Failure Analysis Associates (engineering consulting firm; Phoenix, AZ)
References in periodicals archive ?
PCR primers, annealing temperatures, and product sizes for the detection of virulence genes virulence primers product size gene (bp) gelE AAT TGC TTT ACA CGG AAC GG 548 GAG CCA TGG TTT CTG GTT GT acm GGC CAG AAA CGT AAC CGA TA 353 CGC TGG GGA AAT CTT GTA AA hyl ACA GAA GAG CTG CAG GAA ATG 276 GAC TGA CGT CCA AGT TTC CAA esp AGA TTT CAT CTT TGA TTC TTG G 510 AAT TGA TTC TTT AGC ATC TGG efaA CACGCTATTACGAACTATGA 375 TAAGAAAGAACATCACCACGA cyl TGG ATG ATA GTG ATA GGA AGT 517 TCT TTC ATC ATC TGA TAG TA virulence annealing gene temperature reference ([degrees]C) gelE 52 [17] acm hyl esp 55 efaA [18] cyl Table 2.
Bu calismada, kedi ve kopeklerde ampisiline direncli enterokok (ARE) turlerinin dagilimini, antimikrobiyal duyarlilik profillerini ve bu izolatlarin virulans ile iliskili ace, gelE, efaA, agg ve esp genleri incelendi.
The established overall frequencies of the studied genes encoding adhesins (esp, agg/asa1, ace/acm, efaA), modulators of the host immunity and inflammation (eep), invasins (gelE, hyl), and cytotoxins (cylA) were as it follows: 44.3%, 38.4%, 64.3%, 85.9%, 69.4%, 64.3%, 25.1%, and 47.1%.
This proposal mirrors the FASTT Checks Act's proposals for adjusting the dollar amounts used in the EFAA and Regulation CC to catch up and keep pace with inflation, treating Saturday as a "business day" for the purpose of calculating hold periods, and eliminating hold exceptions for "large deposits." However, unlike the FASTT Checks Act, this Note's proposal would also eliminate "large deposit" exceptions for all banks, not only those that use ECP and have total assets of $10 billion.
Roberto Branco Martins is initiator and director of the Dutch professional football players' agents association ProAgent and general manager of the European Federation of Football Agents (EFAA).
Now the vice-president of European Football Agents Associations (EFAA), Branchini is a been there, done that kind of a personality in his own field.
(6) Under the Expedited Funds Availability Act (EFAA), (7) funds are first made available to the depositor, but are not considered collected until payment is received from the payor bank at final settlement.
Check 21 has its roots in the Expedited Funds Availability Act (EFAA) enacted on August 10, 1987.
Klas-Erik Hjorth, president of the European Federation of Accountants and Auditors for SME's (EFAA) said: "There are some restrictions that would be good to remove--there are various restrictions regarding ownership of accounting firms, regarding who should be on the board and also on opening an office in another country without having an accountant in that country born in that country.
Lee Dickinson of Exponent Failure Analysis Associates (EFAA), an engineering consulting firm.
The Congress further expanded the role of the Federal Reserve in the payments system in 1987, when it enacted the Expedited Funds Availability Act (EFAA).