ERK2


Also found in: Medical.
AcronymDefinition
ERK2Extracellular-Regulated Kinase 2
References in periodicals archive ?
After the samples were blocked in 5% nonfat milk in Tris-buffered saline, immunoblotting was conducted using a primary antibody against SP-A at a dilution of 1:150 or TLR4 at a dilution of 1:500 (Abcam, Britain, ab22048) or NF-kB (Abcam, Britain, ab32536) at a dilution of 1:5000 or IkB-a (Abcam, Britain, ab133462) or MEK1 (Abcam, Britain, ab32091) at a dilution of 1:1000 and phosphorylated MEK1 (p-MEK1) (Abcam, Britain, ab96379) at a dilution of 1:800 or ERK2 (Abcam, Britain, ab32081) at a dilution of 1:1000 and phosphorylated ERK1/2 (Abcam, Britain, ab201015) at a dilution of 1:800 or P38MAPK at a dilution of 1:3000 (Abcam, Britain, ab170099) and phosphorylated P38MAPK (Abcam, Britain, ab47363) at a dilution of 1:500, and then secondary antibody conjugated with horseradish peroxidase.
a) Phosphorylated forms of NF[kappa]B, (b) ASK, (c) ERK1, and (d) ERK2 were evaluated by western blot analyses.
Activation of two isoforms of the MAPK, ERK1, and ERK2 with different molecular weights during oocyte maturation and activation require an active protein synthesis [13].
Primer sequences (5' to 3') ZO-1 ZO-1-f GACTTAAAGCTGCCTCAACA ZO-1-r GGTTTGTTTCAGGCGAAAGT Claudin-1 Claudin-1-f TTCTGGGAGGTGCCCTACTT Claudin-1-r TGGATAGGGCCTTGGTGTTG Occludin Occludin-f CCATGGCCTACTACTCGTCC Occludin-r CGGCACCGGTGTTGATTTAT ERK1 ERK1-f TGCATTCTGGCTGAGATGCT ERK1-r TGAGCTGGTCCAGGTAGTGC ERK2 ERK2-f CCGTGACCTCAAACCTTCCA ERK2-r CCAACCCAAAGTCACAGATC p90RSK p90RSK-f ACCTGGTGTCAAAGATGCTTC p90RSK-r CAGTGGACGATCCAAGGATGT TCGGAAGTGTGTATCCCGTAGG GCAAGGAACACGGCTAAGTTG Gene Annealing GenBank temperature accession no.
The ERK signaling pathway involves an additional protein, ELK1 which interacts with ERK2 to activate the genetic information.
Single and combined silencing of ERK1 and ERK2 reveals their positive contribution to growth signaling depending on their expression levels.
Histidine-tagged ERK2 ligand was captured on an HTE chip and the binding of small molecules from two commercial kinase inhibitor libraries was measured using a single concentration of each molecule.
Poxviral regulation of the host NF-[kappa]B response: the vaccinia virus M2L protein inhibits induction of NF-[kappa]B activation via an ERK2 pathway in virus-infected human embryonic kidney cells.
Al mismo tiempo, la estimulacion de la renina activa los genes ERK1 (MAPK3) y ERK2 (MAPK1), que se relacionan con obesidad y con hipertrofia cardiaca, entre otras cosas (6,7).
Regulation and functional consequences of ADP receptor-mediated ERK2 activation in platelets.
The proteins, called ERK1 and ERK2, appear to bring about the maturation and release of the egg.