ERK2


Also found in: Medical.
AcronymDefinition
ERK2Extracellular-Regulated Kinase 2
References in periodicals archive ?
Primer sequences (5' to 3') ZO-1 ZO-1-f GACTTAAAGCTGCCTCAACA ZO-1-r GGTTTGTTTCAGGCGAAAGT Claudin-1 Claudin-1-f TTCTGGGAGGTGCCCTACTT Claudin-1-r TGGATAGGGCCTTGGTGTTG Occludin Occludin-f CCATGGCCTACTACTCGTCC Occludin-r CGGCACCGGTGTTGATTTAT ERK1 ERK1-f TGCATTCTGGCTGAGATGCT ERK1-r TGAGCTGGTCCAGGTAGTGC ERK2 ERK2-f CCGTGACCTCAAACCTTCCA ERK2-r CCAACCCAAAGTCACAGATC p90RSK p90RSK-f ACCTGGTGTCAAAGATGCTTC p90RSK-r CAGTGGACGATCCAAGGATGT TCGGAAGTGTGTATCCCGTAGG GCAAGGAACACGGCTAAGTTG Gene Annealing GenBank temperature accession no.
The ERK signaling pathway involves an additional protein, ELK1 which interacts with ERK2 to activate the genetic information.
Poxviral regulation of the host NF-[kappa]B response: the vaccinia virus M2L protein inhibits induction of NF-[kappa]B activation via an ERK2 pathway in virus-infected human embryonic kidney cells.
ERK1 and ERK2 are a critical nexus between the surge in luteinizing hormone and ovulation, said Dr Louis V.
Catalytic activation of the phosphatase MKP-3 by ERK2 mitogen-activated protein kinase.
It activates elements, including ERK2, of the same signaling pathway responsible for the therapeutic effects of hematologic growth factors.
Next, nobiletin significantly decreased the levels of phospho-ERK2 and phospho-Akt in ERK2 or Akt siRNA-transfected cells concomitantly with a marked reduction on cell invasion and migration.
pcDNA3-CA-MKK5 [CA-MKK5; constitutively active MAPK kinase (MKK) 5] and dominant-negative (DN) ERK2 (DN-ERK2) were gifts from J.
used samples from 188 patients and found that the simultaneous hyperactivity of three control pathways (PKC-alpha, ERK2 and AKT) is common in AML patients and is associated with especially poor prognosis for these patients.
In a recent paper published in the Journal of Clinical Investigation, MAP kinase (also known as ERK2, extracellular signal-regulated kinase 2, the subject of the UT Southwestern-Regeneron patent) was shown to be hyperexpressed and hyperactivated in breast cancer.