FD1Fire District 1 (various locations)
FD1Figure Detection 1 (neuron)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Conditions Temperature Time Steps 1 Initial 94[degrees] 3 min denaturation 2 Denaturation 94[degrees] 30 sec 3 40 Annealing 50[degrees] for V1 Fw & V6 Cycles Rv56[degrees] for FD1 & RP1 30 sec 4 Extension 72[degrees] 2 min 5 Final extension 72[degrees] 10 min Table 2.
found in green lizards and Ixodes ricinus ticks, Slovakia, 2004-2011 Primer Organism name Sequences, 5' [right arrow] 3' Family EHR747 GCACTCATCGTTTACAGCGTG Anaplasmataceae EHR521 TGTAGGCGGTTCGGTAAGTTAAAG Most eubacteria fD1 CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG rP2 CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT Primer Length of amplified Organism name fragment, bp Reference Family EHR747 247 (10) Anaplasmataceae EHR521 Most eubacteria fD1 1,500 (9) rP2 Table 2.
To analyze the effects of the agitation ([X.sub.1], temperature ([X.sub.2]), and pH ([X.sub.3]) at enzymatic production of xylanase in medium with soybean residue, two factorial designs were employed (FD1 and FD2).
Fragments of the 16S rRNA genes of each bacterial isolate were separately amplified using the eubacteria universal primers rD1 (5'-AGA GTT TGA TCC TGG CT C AG-3') and fD1 (5'-AAG GAG GTG ATC CAG CC-37) [16].
"Empirical strategy" section presents our data sources, GVC metrics and empirical strategy as well as empirical results from a gravity model augmented by FD1 stock.
TABLE 8 Comparing Coefficients for FD1 with and without HMT (1) (2) (3) Product Innovation Exporter 0.039 (***) 0.044 (***) (0.000) (0.000) FDI with HMT -0.001 -0.019 (***) (0.001) (0.001) Constant 0.029 (***) 0.040 (***) 0.031 (***) (0.000) (0.000) (0.000) Observations 760,777 760,777 760,777 R-squared 0.081 0.072 0.082 (4) (5) (6) Product Innovation > 0 Exporter 0.126 (***) 0.145 (***) (0.001) (0.001) FDI with HMT -0.007 (***) -0.065 (***) (0.001) (0.001) Constant 0.065 (***) 0.101 (***) 0.070 (***) (0.000) (0.000) (0.000) Observations 762,883 762,883 762,883 R-squared 0.141 0.110 0.146 Notes: The dependent variable in columns 1-3 is new product's share of total output, while columns 4-6 use a dummy that is 1 if new products represent a positive share of outputs.
FD1 flow Gross FDI flow in Euros, by region in Spain and by country of the last owner.
FD1 and FD2 have relatively high ratings, indicating that there may be an issue and they also have a higher deviation.
In this work, universal primers of fD1 and rP2 were used for PCR amplification of 16S rRNA gene region and nearly 1500 bp long amplicons were obtained as in previous reports of 16S rDNA-PCR for Pectobacter Kang et al.
The 16S rDNA gene of the six isolates was amplified by polymerase chain reaction (PCR) using primers fD1 (5'AGAGTT TGATCCTG GCTCAG 3') and Rs16 (5'AAG GAG GTG ATC CAA GCC 3') [30].
For bacteria, part of the 16S ribosomal gene was amplified using primers fD1 and rP2 [23].
For 16S rRNA gene amplification, the following primers were used: Forward fd1 5'-AGAGTTTGATCCTGGCTCAG -3' and reverse rP2 5'ACGGCTACCTTGTTACGACTT -3' [32] at a final concentration of 0.2 [micro]l.mol.