FOLP

AcronymDefinition
FOLPFramework for Open Learning Program (Australia)
FOLPFitness Ontario Leadership Program
FOLPFriends of Lafayette Park (various locations)
FOLPFriends of Lincoln Park (Chicago, IL)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Out of 17 cases tested for sequencing, during the year 2009, none showed mutations in folP1, rpoB or gyrA, whereas in the year 2011, three out of 11 tested were folP 1 mutants and no rpoB and gyrA mutation noted.Under the same WHO DRS study from North India, none of the seven samples tested showed mutations to folP1, rpoB or gyrA gene in the year 2009.
of New Cases Name of Author Study period Country registered Present study 2011-2014 South-East India 234 Liu D (20) 2012-2014 China 85 Guerrero MI (19) 1985-2004 Colombia 381 Sekar B (18) 2005-2007 South India 11 Kai M (17) 2004-2009 Vietnam 83 Singh P (24) 2009-2011 Venezuela & 230 South American countries Matsuoka M (16) 2000-2006 Myanmar, Indonesia 252 and Philippines Contreras Mejia 2009-2011 Brazil 126 Mdel C (25) Mutation rate % Name of Author folP rpoB gyrA Present study 0 0 0 Liu D (20) 1.5% 8.8% 25.9% Guerrero MI (19) 0.43% 3.19% 1.17% Sekar B (18) 0.09% 0 0 Kai M (17) 0.2% 0 0 Singh P (24) 0 0 0 Matsuoka M (16) 3% 2% 0 Contreras Mejia 0 2.4% 0 Mdel C (25)
All serotype 15A-ST63 isolates from Japan had tetM and ermB genes and were negative for the ermTR, tetO, mefA, and mefE genes; folA mutation; and folP insertion (online Technical Appendix Table 3).
([section]) For a description of WGS-based bioinformatic pipeline for deduction of all features shown, see Metcalf et al.(6,12).For a description of folP insertions (folPins178, folP189), see Figure 1 in Metcalf et al.(12).
DETECTION OF MUTATIONS BY PCR TARGETING rpoB, folP and gyrA
Primer sequences used in this study were as follows folP primersfolPF CTTGATCCTGACGATGCTGT; folPR CCACCAGACACATCGTTGAC, rpoB primers rpoBF GTCGAGGCGATCACGCCGCA; rpoBR CGACAA TGAACCGATCAGAC and for gyrA primers gyrAF ATGGTCTCAAACCGGTACATC; gyrAR TACCCGGCGAACCGAAATTG.
Among these 111 sequenced samples, 4 (3-6%) showed mutations in the rpoB and nine (8-1%) each in the folP and gyrA genes.
Resistance genes identified by whole-genome sequencing of an ESBL-producing mcr-1-positive Klebsiella pneumoniae strain isolated from a 38-year-old man, France * Resistance gene Target antimicrobial drug mcr-1 and inactivation of Colistin mgrB by IS5 insertion [bla.sub.SHV-106] [beta]-lactams aac(3)-IId and aadA16-like Aminoglycoside aac(6')Ib-cr Quinolone and aminoglycoside fosA5 Fosfomycin sulI and folP Sulfonamide dfrA27 Trimethoprim tetD Tetracycline * ESBL, extended-spectrum [beta]-lactamase.