FSEL

AcronymDefinition
FSELFerguson Structural Engineering Laboratory (University of Texas at Austin)
FSELFlight Safe Exposure Limits (US FAA)
References in periodicals archive ?
Equation (1) is specially designed to simplify the control mechanism in high-speed operation since FS1 can be the one's complement of FSEL without any extra arithmetic circuitry.
When the input clock ([CLK.sub.FINE]) changes its phase with the different fine selection value (FSEL), the feedback clock ([CLK.sub.C7]) will not be aligned with the input clock.
Primer 5' end length, position Amplification Primer sequence S' to 3' nt (a) (b) F1-F2 F1(S) GGGGACACCATCTACAGTG 19 -937 F2(As) GGAGGAGGGGGCAACAGG 18 -500 F3-F4 F3(S) TTCAAGACCACCCACCTTCT 20 $597 F4(As) TCGCGGGTGCTGTTGTACA 19 $1,078 Product Recognition length, sequence, (c) Amplification bp RSP Enzyme 5' to 3' F1-F2 455 -800 MaeIII [down arrow] GTNAC -509 Aocl CC [down arrow] TNAGG F3-F4 500 Codon 10 MspA1l CTG [down arrow] CTG (d) Codon 25 Fsel GGCCGG [down arrow] CC Base Restriction Amplification substitution site F1-F2 G [right arrow] A Present C [right arrow] T Present F3-F4 T [right arrow] C (Leu [right arrow] Pro) Absent G [right arrow] C (Arg [right arrow] Pro) Present (a) nt, nucleotides; S, sense; As, antisense.