FSHR


Also found in: Medical.
AcronymDefinition
FSHRFollicle-Stimulating Hormone Receptor
FSHRFree-Standing Hybrid Riser (oil and gas drilling)
FSHRFour Seasons Hotels and Resorts
FSHRFriesian Sport Horse Registry
References in periodicals archive ?
Sequences for gene-specific PCNA, FSHR , and GAPDH primers were as follows: PCNA forward: AGGAGGCGGTAACCATAG, PCNA reverse: ACTCTACAACAAGGGGCACATC; FSHR forward: CCAGGCTGAGTCGTAGCATC, FSHR reverse: GGCGGCAAACCTCTGAACT; and GAPDH forward: GGAAAAGAGCCTAGGGCAT, GAPDH reverse: CTGCCTGACGGCCAGG.
2 Follicular maturation INHA 2q33-36 Folliculogenesis regulation via FSH inhibition FSHR 2p21 Growth and development of the follicle, steroidogenesis LHR 2p21 Follicle maturation, steroidogenesis, ovulation ESR1 6q25.
Although FSH interacts with the large extracellular N-terminal domain of its receptor, small molecules have been designed that can activate or inhibit the FSHR (Arey et al.
19,20) Recently, Mariani and colleagues evaluated FSHR up-regulation and subsequent response to FSH in prostate cancer cell lines, suggesting an association with androgen sensitivity.
Two FSHR variants, haplotypes and meta-analysis in Chinese women with premature ovarian failure and polycystic ovary syndrome.
Association between the expression of LHR, FSHR and CYP19 genes, cellular distribution of encoded proteins and proliferation of porcine granulosa cells in real-time.
Because 3' UTR sequences of porcine CYP19A1 and FSHR genes have not been reported, we aligned the 3' flanking sequences of these two genes with the respective human 3' UTR sequences to get the consensus sequences for further prediction.
Regulation of the expression of FSHR and its connection with specific signal transduction pathways are key points in regulating folliculogenesis (Findlay and Drummond, 1999).
We found that there were significant differences in mRNA expression of ESR and FSHR genes not only between hybrids and their parental lines (p < 0.