GAATGuardianship and Administration Tribunal (Queensland, Australia)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
Na mesma linha da publicacao canadense, o Guia de Analise Acidentes de Trabalho (GAAT) do MTE apresenta bases conceituais e metodologicas necessarias para a compreensao dos eventos acidentarios.
The 2.3 kb full-length vip3A gene was ampliued with primers VCL1 (ATAAGAATGCGGCCGCATGAACAA GAAT AATACTAA) and VCL2 (ACCGCT CGAGTTA TCTAATAGAGACATCGT) [19) using a thermal cycler (Bio-Rad T100).
Having settled the Baleh, Iban, with reinforcements from Iban settled on the Julau and Entabai Rivers, drove the Lugat nomads from their territory on the Gaat over the watershed into the Mahakam (Sandin 1994:199).
In this way, we arrive at two versions of the generalized Alchian-Allen theorem (GAAT), which essentially provides a decomposition of an uncompensated change in the demand ratio of two goods into a substitution effect (compensated effect) and an income-endowment effect.
In de Amsterdamse Schouwburg gaat Vondels Gebroeders in premiere.
He said about Gaat: "Speech poem origins back to the Gaats in Avesta.
Nested primers specific for either CAV (CAV F1n 5' GGCAGTGAATCGGCGCTTAGCCG and CAV R1n 5' AGTCGCTTGAGGTGGTGCCACCG) or AGV2/HGyV1 and GyV3 (ConGy F1n 5' GGCAGT GAAT T GCCGCTTAGGC and ConGy R1n 5' CGCAGTCTGTGTCTCCAGTGC) were used to improve sensitivity.
Each module includes a written exam and hands on, scenario driven practical exercises, all of which tie into the GAAT scenario for continuity throughout the course.