GAPDH


Also found in: Medical.
AcronymDefinition
GAPDHGlyceraldehyde-3-Phosphate Dehydrogenase (also seen as G3PDH)
References in periodicals archive ?
Gene Sequence (5'-3') VP1 F: TGGCAGATGTGATTGAGAG R: GGCTTGAAGTGCTGGTA IL-1[beta] F: ATGATGGCTTATTACAGTGGCAA R: GTCGGAGATTCGTAGCTGGA IL-6 F: AGGAGACTTGCCTGGTGAAA R: CAGGGGTGGTTATTGCATCT IL-8 F: TTGGCAGCCTTCCTGATTTC R: TCTTTAGCACTCCTTGGCAAAAC TNF-[alpha] F: GAGGCCAAGCCCTGGTATG R: CGGGCCGATTGATCTCAGC GAPDH F: GCACCGTCAAGGCTGAGAAC R: TGGTGAAGACGCCAGTGGA F: forward; R: reverse.
Intestinal IELs were isolated at day 20, and the levels of (A) IL-8 and (B) TNFSF15 mRNAs were measured by quantitative RT-PCR at day 20 and normalized to GAPDH transcript levels.
1% Tween 20 (TBST) and 5% nonfat milk and incubated overnight at 4[degrees]C with primary antibodies against HDAC1 (10197-1-AP, Proteintech, 1:1000), HDAC2 (12922-3-AP, Proteintech, 1:1000), HDAC3 (10255-1-AP, Proteintech, 1:500), MRP2 (sc-20766, Santa Cruz, 1:100) and GAPDH (CW0100A, CWBIO, 1:500).
Primer sets of AF/RB1, FB/RB5, FB/RB4, B2S/RB2 and GAPF/GAPR were used to amplify OCT4A, OCT4B, OCT4B1, OCT4B3, and GAPDH, respectively.
El analisis de la RT-PCR en Tiempo Real del ARNm del gen GAPDH, IL-5, IL6, TGF-[beta] e IgA mostro una homogeneidad en las curvas de amplificacion y curvas de disociacion de un pico unico sin presencia de productos inespecificos con valores de temperatura de disociacion cercanas entre si (Cuadro 2).
In the present study, the six housekeeping genes, B2M, ACTB, EF-1a, GAPDH, 18S rRNA, and 40S, in different tissues, gender, and gonads of Yellow River carps at various developmental stages, including undifferentiated larvae (40-55 day after hatch (dph)), 1-year-old juveniles, and 2-year-old adult carps, were investigated.
Sequences of primers used for real-time quantitative RT-PCR Gene Forward primer (5' [right arrow] 3') MUC1 TGCCTTGGCTGTCTGTCAGT GAPDH GTGAACCATGAGAAGTATGACAA Gene Reverse primer (5' [right arrow] 3') References MUC1 GTAGGTATCCCGGGCTGGAA [19] GAPDH CATGAGTCCTTCCACGATAC [20]
The primers and conditions optimized in the present study were sensitive, fast and reliable in the detection and quantification of cytokine mRNAs, and the GAPDH gene was demonstrated to be an ideal internal control gene in bovine experiments.
Gene expression assay: Expression of LH[beta] and GAPDH mRNA in the pituitary of male rats is shown in figures 4A and 4B, respectively.
Thereafter, the DNA of input samples and ChIP samples was subjected to RTPCR with the appropriate primers: primers for NF-[kappa]B (forward, 5'-TGCTGAAGAAAGACCACTGC-3' and reverse, 5'- GCTTCCGTTGCACCTCTCT-3'); for GAPDH (forward, 5'-TCTGCAGGAGAC AAGACCTG3'; reverse, 5'-GACTTGAGGAGCTGGAGAGG-3').
Table 7: Primers and probes selected kits 'details of BRCA1, COX-2 and GAPDH genes