GBPB

AcronymDefinition
GBPBGlucan-Binding Protein B
GBPBGameBoy Prototyping Board
References in periodicals archive ?
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
The expression profile of gtfB, gtfC, gtfD, ftf, relA, spa P, vic R, smuO160 and gbpB in S.
Paraprofessional June Barkley sums it up, "Last year my 401(k) plan went down 30 percent, but my GBPB stock went up 10.5 percent.