GCARA

AcronymDefinition
GCARAGreater Cincinnati Amateur Radio Association
References in periodicals archive ?
The primers used for real-time PCR assay Target group Forward primer Reverse primer Bacteria (1) CGGCAACGAGCGCAACCC CCATTGTAGCACGTGTGTAGCC Methanogens (2) TTCGGTGGATCDCARAGRGC GBARGTCGWAWCCGTAGAATCC Methanobacteriales (3) CGWAGGGAAGCTGTTAGT TACCGTCGTCCACTCCTT Methanomicrobiales (3) ATCGRTACGGGTTGTGGG CACCTAACGCRCATHGTTTAC Methanosarcinales (3) GTAAACGATRYTCGCTAGGT GGTCCCCACAGWGTACC Methanococcales (3) TAAGG GCTGG GCAAG T CACCT AGTYC GCARA GTTTA Annealing Amplicon temp.