GCCC

Category filter:
AcronymDefinition
GCCCGarden City Community College (Garden City, Kansas)
GCCCGulf Coast Community College
GCCCGold Coast City Council (Queensland, Australia)
GCCCGloucester County Community Church (New Jersey)
GCCCGay Classic Car Club (Netherlands)
GCCCGreater Cincinnati Chamber of Commerce
GCCCGloucestershire County Cricket Club
GCCCGolf Club at Circle C (Austin, TX)
GCCCGlobal Congress on Combating Counterfeiting and Piracy (various organizations)
GCCCGlamorgan County Cricket Club
GCCCGarden City Community Clinic (Boise, ID)
GCCCGreater Chicago Combine and Center, Inc. (homing pigeon keepers)
GCCCGround Control Computer Center (NASA)
GCCCGreg Chappell Cricket Centre (Australia)
GCCCGlobal Chapter Chairs Congress (IEEE Communications Society)
GCCCGlobal Contingency Construction Contract
GCCCGovernment Charter Coach Certificate
GCCCGrand Challenge Cosmology Consortium (also called GC3)
GCCCGlobal C4S Coordination Center
GCCCGround Combat Command and Control (program manager under PEO C3T)
GCCCGulf Coast Christian Center (Mobile, AL)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
A statement on the group's website said: "Massive thank-you from Team GCCC to everyone who made Granite City Comic Con 2019 a great day.
Convention organiser Chris Robertson said: "We're really happy to be back at the Hilton for our fifth year of GCCC, and looking forward to a great day of geeky entertainment.
GCCC operations manager Hesham Al Haddad said according to their code of ethics there is no difference between someone offering money or someone asking for money.
The specific tips outlined in this article are ones that have been implemented at GCCC, and my hope is that they will spark ideas for how you can advocate for your own school and programs.
This is also the 10th year since GCCC merged with Quapaw Technical Institute to become a brand new community college.
The Goose Creek Correctional Center (GCCC) emulates a small city to better prepare inmates for community reentry upon their release.
Toxin Primer F Primer R gene (5'[right arrow]3') (5'[right arrow]3') speA ACTTAAGAACCAAGAGATGG CCTTATTCTTAGGTATGAAC speB GGATCCCAACCAGTTGTTAAATCTCT AACGTTCTAAGGTTTGATGCCTACAA speC AAGTGACTCTAAGAAAGACA TTGAGTATCAATGTTTAATG speG AGAAACTTATTT GCCC TAGTAGCAAGGAAAAGG smeZ TAACTCCTGAAAAGAGGC CATTGGTTCTTCTTGATAAG Toxin Size of Reference gene amplification product (bp) speA 309 Weeks et al.
Through Etisalat SIM cards, a Global Command Control Centre (GCCC), assesses the electricity consumption of chillers and electronic devices used at those buildings.
While CREAM-MAC is designed based on a four-way dialog (RTS, CTS, Channel-State-Transmitter: CST and Channel-State-Receiver: CSR packets) on the GCCC, the SCA-MAC employs only a two-way handshake of the control frames (Channel Request to Send and Channel Clear to Send) on the GCCC to facilitate the sender and receiver to tune their transceivers to a mutually agreed upon data channel.
Only five Queensland coastal councils have prepared climate change strategies or action plans, including Brisbane (BCC 2007); Cairns (CRC 2009, 2010); Gold Coast (GCCC 2009); Redland (RCC 2010), and Sunshine Coast (SCC 2010).
The newspaper indicated Amman was seeking GCCC support to help it pass through current hard economic conditions.