GCKFGerman Chinese Kuoshu Federation
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Target gene (5' to 3;) Primer sequences Product length G6Pas_F caccgactactacagcaacagc 209 G6Pas_R agaatcccaaccacaagatgac GCKF cttcaccttctccttccctgtaa 145 GCK_R aaagtcccctctcctcttgatag PEPCK.F agtcatcatcacccaagagc 154 PEPCKR tgggatgacatacatggtgc [beta]-actin-F cagccttccttcttgggtat 91 [beta]-actin-R ggtctttacggatgtcaacg TABLE 3: qRT-PCR reaction system.