GCTG

AcronymDefinition
GCTGGreater China Technology Group Ltd. (China)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Being the oldest technical institute of Karachi, GCTG Kareemabad actually provides three-year Diploma of Associate Engineers (DAE) in various trades including Food Technology, Garments, Electronics and Architecture.
The event hosted at Bank Muscat head office was attended by Sulaiman Al Harthy, deputy chief executive officer - Islamic Banking, key representatives of the Authority for Electricity Regulation (AER), the German Clean Tech Group (GCTG), the German Industry and Commerce of Oman (AHK) and Nafath Renewable Energy (Nafath), who addressed the forum and interacted with business leaders and entrepreneurs keen to tap investment opportunities in the renewable energy sector.
[beta]-Actin was an endogenous control which was used for gene expression analysis: forward: 5 CTCCATCCTGGCCTCGCTGT 3' and reverse: 5' GCTG TCACCTTCACCGTTCC 3'.